Busch Lab

ZMP

ENSDARG00000091674

Ensembl ID:
ENSDARG00000091674

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa13059 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13059
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124634 Nonsense 103 210 3 6
Genomic Location (Zv9):
Chromosome 14 (position 41132723)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 39460801
GRCz11 14 39828799
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAGCTACTTCGCCTTCGACCCACACACCGTCAGCATCGAGGACTTCTTC[G/T]GAGACCTGGCTAACTTCCGCAACCTCTTCATGGTGAGTACAGAACCRCTG
Associated Phenotype:
Not determined