Busch Lab

ZMP

WSCD1 (1 of 3)

Ensembl ID:
ENSDARG00000091641
Description:
WSC domain containing 1 [Source:HGNC Symbol;Acc:29060]
Human Orthologue:
WSCD1
Human Description:
WSC domain containing 1 [Source:HGNC Symbol;Acc:29060]
Mouse Orthologue:
Wscd1
Mouse Description:
WSC domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2448493]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa32116 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22980 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32116
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106061 Essential Splice Site 259 375 5 6
Genomic Location (Zv9):
Chromosome 17 (position 3057634)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29965607
GRCz11 17 3284851
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGCTGGGCATCTGGGCTACGCTTCTGATCAGCACTGGAAGGGCAAAGG[T/C]ATTATGGGCATCTCTTTGTTCAGTTGAGCTCCGCAGGCACTGGGACTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22980
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106061 Nonsense 270 375 6 6
Genomic Location (Zv9):
Chromosome 17 (position 3056078)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29964051
GRCz11 17 3283295
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCTCTTCTTTCCAGAGTGGCCAGAGTTTGTGGGTAGTTATGCCTCCTG[G/A]TGGGCCTCTCATGTGCTGGATTGGCTGCGCTTTGGAAAGCAGCTTCTGGT
Associated Phenotype:
Not determined