Busch Lab

ZMP

ENSDARG00000091585

Ensembl ID:
ENSDARG00000091585
Human Orthologue:
RP11-439E19.8
Human Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B7ZC32]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa10417 Nonsense Available for shipment Available now
sa19165 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28816
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123256 Nonsense 38 339 2 8
Genomic Location (Zv9):
Chromosome 17 (position 12054997)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12037519
GRCz11 17 12191585
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTGGAAATCAAGAATCTGGCGATGTCGGACTCTAAAGGTCATGACCTA[G/T]AGAAGGACATCGCTGTGAAAGTGACGTCTGTAGAGAGCAAACAGGTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10417
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123256 Nonsense 175 339 4 8
ENSDART00000123256 Nonsense 175 339 4 8
Genomic Location (Zv9):
Chromosome 17 (position 12049377)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12031899
GRCz11 17 12185965
KASP Assay ID:
2261-0714.1 (used for ordering genotyping assays)
KASP Sequence:
ACCCKTCAGAGCTGCTTGGCAAACGGCTGGACTTTCAGCTGGTTTTGGAT[C/T]AGTGCTGTGGATTACGCTGGGTTAAAGAGGCTCGGAACAGAGGCGTGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19165
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123256 Nonsense 175 339 4 8
ENSDART00000123256 Nonsense 175 339 4 8
Genomic Location (Zv9):
Chromosome 17 (position 12049377)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12031899
GRCz11 17 12185965
KASP Assay ID:
2261-0714.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCTTCAGAGCTGCTTGGCAAACGGCTGGACTTTCAGCTGGTTTTGGAT[C/T]AGTGCTGTGGATTACGCTGGGTTAAAGAGGCTCGGAACAGAGGCGTGCAA
Associated Phenotype:
Not determined