Busch Lab

ZMP

ENSDARG00000091573

Ensembl ID:
ENSDARG00000091573
Human Orthologues:
RAP1GAP, RAP1GAP2
Human Descriptions:
RAP1 GTPase activating protein 2 [Source:HGNC Symbol;Acc:29176]
RAP1 GTPase activating protein [Source:HGNC Symbol;Acc:9858]
Mouse Orthologues:
Rap1gap, Rap1gap2
Mouse Descriptions:
RAP1 GTPase activating protein 2 Gene [Source:MGI Symbol;Acc:MGI:3028623]
Rap1 GTPase-activating protein Gene [Source:MGI Symbol;Acc:MGI:109338]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36183 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36183
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125411 Essential Splice Site 100 453 4 15
Genomic Location (Zv9):
Chromosome 16 (position 34152553)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31975037
GRCz11 16 31930625
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATAGTGGAAAATAAATTACTTGCATGCATTTCTTTACTCTTTTACTGC[A/G]GTATCATCATTCATTCACCGCCTGTGACCCTGCTCTTGGGCCTCTAGTTT
Long Flanking Sequence:
ATTATTCCTAATTACAATAAAATAGAAACTATTCGTACAAGTATTTTGTTTATTGTTAGAATACTTACCAACATTACTGTTTTAATTGCATTAATTGCAGCCTAAGTGACCATCTTTCAAAAACTTTTTTAAAAAGTCATAGTGACCACAAATTAGAATGAAAGTTTATCATTTTAACTTTACTGATCACCCAGACACGACTGCTAAAGATTGGAGATGGCTTACCTCTCATCCTGCCTCCTAAATCTGGAGGTTATTGGATCGACCCTCCTCTGGATAAACAAGTGGAGACCAGTCCAACTCTTTCTCAGGGGGGGTTCGGCCTGGAGAGCTACGACATCATGGAGAGAGACAGTGAAGCTAAAGTCTATCAGGAGTTTTTCCGCCACAGAGTCAGTGATTTTTCTATTACAGAAAAGTTTATCAATGCCACATAACTGTTGAAGTTCTGAATAGTGGAAAATAAATTACTTGCATGCATTTCTTTACTCTTTTACTGC[A/G]GTATCATCATTCATTCACCGCCTGTGACCCTGCTCTTGGGCCTCTAGTTTTGTCTGTTTGTCTTGAGGAAGAGGAAAATCGTTTAAGGGTCATTCTGAGGTGTGTTTTTCGTGACCACTTCACATGATGTTAAATAACTTGCTCTACCAGAACATCCTGATAAATGTTCGTTTTCCCCAATTAATCAGGATGAAGGAGTGCTCAATTCATGGCACATTCTCAGTTTCTCTCTTTCAACAATTCCCCACAGCAGTGGAGTTGGCAAAGGTAAAACACAGCCGGCTGCACTTGCCTCACATTTAAATGAATTTGAAAAGACGTTTAATTTGCTGTGATTTGTTTTGTTGAAGATGCTGTGCTCGAATGTCAATGTGATGTGTTTTGAGGCTGTGAGTTACTTAAAGGTAACCTTTACTTGTTAAATCCATCTTTGATTTAGTGGTAATATAATACTAACTAATCTGCTTTGACATATTCAAAAAATAAATTATTTCGTAGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7797
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125411 Essential Splice Site 357 453 12 15
Genomic Location (Zv9):
Chromosome 16 (position 34149041)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31971525
GRCz11 16 31927113
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGTGCCCCCATTTGGCCCACCCCTTCCCACACCACCCATTTTTACAGAG[G/A]TAAAAACAAATGACAGAGTGCTTTAGATTTCTGTAAGATAGTTTTTACCT
Long Flanking Sequence:
AGTTGACTAAAAAAAGAGGTTTGGCGCTACCTACTGGTGACTCCAAATAACTTGCAAAATAATATTAAATATTCATCAATACACACAATAGAGGACAGAAAACAAAGTTAAGCATCATTTTCATTTTCCTTGAATGACAACCCTATTTCTCTGTTTCCCCTCAGCTGCAGAGAAAAAGGCACATTGGGAATGATATTGTTGCTCTGGTGTACCAGGAGGGTCACACTCCATTCATTTCAGATGTGATCAGATCCCATTTCTTGCATTGTTTCATTGCAGTTCGGAGGATAAAGAGAGAAAATGAGGGAGAGGGAGGAGATGGAGGATCCTTTCAAGTAAAATAAAACATGTTAAAAAATGATTAGAAAATTGTTAAATAATACGTTATCAGCACCCACTGCTTCAAAGCTTTTTTTTCTGATTGACAGGTGTCTGTCACTGCTAGGGAGGATGTGCCCCCATTTGGCCCACCCCTTCCCACACCACCCATTTTTACAGAG[G/A]TAAAAACAAATGACAGAGTGCTTTAGATTTCTGTAAGATAGTTTTTACCTTTTTGATATCTGTATAATTATTCACCATGTGGATTCAGATCAAACATGTGGGTATACCTACATAATTTAATTGATGATGAGATGTGATTAATAAAAAGAAATATCAACAAAACAATCAAGTCACACTATAAATTTTCAACAGGCGTCTCTCTGCATTTTATTTTTCAGGGCTCTGTTTTGAGAGAGTTCCTCTTGACCAAACTTATAAATGCTGAAATCTCTTGTTACAAGGCTGAAAAATTCAGTCGACTGGAGGTAATCAGGCACCAAACATCCTAAAAAATATAAGGACAGTTCCATAAATTCACAATATTTACAGTTTATTTACCCACTCCCAGGCCATCAAATGTTTAATTAATAAAATGCAAGTCAATGTACTGTATAAAGAAAATTGTAAAAACTAAAATAAAAATACAGAAAAAAAACTAAATTACCTACTGGCAATGGGCT
Associated Phenotype:
Not determined