Busch Lab

ZMP

ENSDARG00000091570

Ensembl ID:
ENSDARG00000091570

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa12983 Nonsense Available for shipment Available now
sa9439 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12983
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125929 Nonsense 103 748 2 9
Genomic Location (Zv9):
Chromosome 24 (position 41280126)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39819320
GRCz11 24 39707167
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTACCAGAACTGGTATCCCGGCCATCCCGTGCCKAACACAGAAAAAAAA[C/T]AGCCAATCTGCCCAACCACACAAACTCCACTCACCTCCACAACCACAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9439
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125929 Nonsense 649 748 7 9
Genomic Location (Zv9):
Chromosome 24 (position 41294896)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39834090
GRCz11 24 39721937
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ASGATTAATTATACAGTCAAGTATCATACGCCTTTTTGGAATGAAGATTA[T/A]ACATTAAATACCAGTGACACACATCTTACCTTTCCTAATTTAAGAAGTGG
Associated Phenotype:
Not determined