Busch Lab

ZMP

si:ch211-251f6.7

Ensembl ID:
ENSDARG00000091558
ZFIN IDs:
ZDB-GENE-031116-3, ZDB-GENE-031116-3, ZDB-GENE-031116-3, ZDB-GENE-071004-119, ZDB-GENE-071004-119, ZDB-GENE-071004-119, ZDB-GENE-091113-57
Description:
hypothetical protein LOC386720 [Source:RefSeq peptide;Acc:NP_942119]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa21654 Essential Splice Site, Splice Site Available for shipment Available now
sa38776 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa21654
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099033 Splice Site None 261 None 6
ENSDART00000123023 Splice Site None 286 None 7
ENSDART00000142714 Essential Splice Site 1 266 1 6
Genomic Location (Zv9):
Chromosome 10 (position 7081806)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8094606
GRCz11 10 8053306
KASP Assay ID:
554-6647.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATCACTTTGACTGTAGAATCCTGCTCAAACAAGACAAGACAAGGTTAT[G/T]TTCAAATAATTACTGTCATTGTGTTGCTGAGGCTGTCTTTACTTTGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38776
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099033 Nonsense 9 261 2 6
ENSDART00000123023 Nonsense 34 286 3 7
ENSDART00000142714 Nonsense 14 266 2 6
Genomic Location (Zv9):
Chromosome 10 (position 7081684)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8094484
GRCz11 10 8053184
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTAAGAACAGGTCCAAACAGAACATGTATTGTGGAGCTATGAAGGTTTA[T/A]CAAGGTGTTTTGCTGCTCTTGAGTTGCCAGATCCTTTACACTCTGGGTAA
Associated Phenotype:
Not determined