Busch Lab

ZMP

FAM190B (2 of 2)

Ensembl ID:
ENSDARG00000091535
Description:
family with sequence similarity 190, member B [Source:HGNC Symbol;Acc:29197]
Human Orthologue:
FAM190B
Human Description:
family with sequence similarity 190, member B [Source:HGNC Symbol;Acc:29197]
Mouse Orthologue:
Gcap14
Mouse Description:
granule cell antiserum positive 14 Gene [Source:MGI Symbol;Acc:MGI:101859]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa27911 Nonsense Mutation detected in F1 DNA Not yet available
sa9515 Nonsense Available for shipment Available now
sa41980 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa27911
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126866 Nonsense 54 814 1 11
Genomic Location (Zv9):
Chromosome 12 (position 14149557)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13005210
GRCz11 12 13043513
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTCCCTCCTATGAGTGTAAAGGTGGACCTGTAGGCAGGCAGAATGGTT[T/G]AACACAAGTTCGATCCTTAAACTGGAGAAAGTGTGAAGAGGAAACTGGAA
Long Flanking Sequence:
CCTCTGTCTCTGTAACAAGAATGCACTGAGATTCCCGTGTTTGTTGACAACCAAACTGTCGTAAAAGCATACTGTGCGTCTCCTCCAAGCTTCCCCCCCGAGAAATGTCAGTCTATAGCAATAGATGATTGTCACCTGAAGTAGTTAGCGGGGCTTCATTCCCCATATTGACCGTTACACTTTTCCCCATTCAAAACTATGAGTGACATGTCTTGTGTATTCTATAGTATTTGCTATTGTGTACAAAAGACTAGCTATTGTGTTTCTTGGTTCATATTTCATGATTTCTCTTTATCTGATTTTACAGTTCTGTCCACATCCATGGTGGTGAACCCAGCTGATGGAAAAGAAGGCTCTCAAGCAGCTCAACATGGTCTCTAGGCTGCCCAAGTTTTCTTCCCGCAGCTCAGGCACCACCACGTCTCCCCTACCTCAAGGATCTGGACTCCCAGTTCCCTCCTATGAGTGTAAAGGTGGACCTGTAGGCAGGCAGAATGGTT[T/G]AACACAAGTTCGATCCTTAAACTGGAGAAAGTGTGAAGAGGAAACTGGAAATAATGTTCAATGCAGTAGAAGCCTGGATGAGGAAACTAGTGCAACTATAGATTCAGACTCCCCTTTAATGGTGACTAAAAAACTTTCCCCTGCTGCTGTAGTTAAATGTAAGAGTGCAGTTTCGACAGCACAATGTAGGAGTATACCACAGCCTACCAAAACCGTTTCCCGCATGACTACCCCCAAACGCCTCTCCACAGGCAACACTATATACAATGGCATGGGTACTCTGAATGGAGCCAGTAGTGGTAATGAACGCTCTTCAGGGTCTGGTCTTGGTCACGTTTCACAACAAAAAAGCTTGCAGAGCAAACTGTCCCTGTCCAGTGACCGTATCAAGTCTACTTCTAAAGAGAGCATAGAGCGCTCTCAGAGTTTCACATACTTTAAGAGGGGAGCATCTCATACTGACCCACCTATGACCAGGTCTTTTTCCTTTAATAAAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9515
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126866 Nonsense 115 814 1 11
Genomic Location (Zv9):
Chromosome 12 (position 14149375)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13005028
GRCz11 12 13043331
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACTTTCCCCTGCTGCTGTAGTTAAATGTAAGAGTGCAGTTTCGACAGCA[C/T]AATGTAGGAGTATAYCACAGCCTACCAAAACCGTTTCCCGCATGACTACC
Long Flanking Sequence:
TTCCCCATTCAAAACTATGAGTGACATGTCTTGTGTATTCTATAGTATTTGCTATTGTGTACAAAAGACTAGCTATTGTGTTTCTTGGTTCATATTTCATGATTTCTCTTTATCTGATTTTACAGTTCTGTCCACATCCATGGTGGTGAACCCAGCTGATGGAAAAGAAGGCTCTCAAGCAGCTCAACATGGTCTCTAGGCTGCCCAAGTTTTCTTCCCGCAGCTCAGGCACCACCACGTCTCCCCTACCTCAAGGATCTGGACTCCCAGTTCCCTCCTATGAGTGTAAAGGTGGACCTGTAGGCAGGCAGAATGGTTTAACACAAGTTCGATCCTTAAACTGGAGAAAGTGTGAAGAGGAAACTGGAAATAATGTTCAATGCAGTAGAAGCCTGGATGAGGAAACTAGTGCAACTATAGATTCAGACTCCCCTTTAATGGTGACTAAAAAACTTTCCCCTGCTGCTGTAGTTAAATGTAAGAGTGCAGTTTCGACAGCA[C/T]AATGTAGGAGTATACCACAGCCTACCAAAACCGTTTCCCGCATGACTACCCCCAAACGCCTCTCCACAGGCAACACTATATACAATGGCATGGGTACTCTGAATGGAGCCAGTAGTGGTAATGAACGCTCTTCAGGGTCTGGTCTTGGTCACGTTTCACAACAAAAAAGCTTGCAGAGCAAACTGTCCCTGTCCAGTGACCGTATCAAGTCTACTTCTAAAGAGAGCATAGAGCGCTCTCAGAGTTTCACATACTTTAAGAGGGGAGCATCTCATACTGACCCACCTATGACCAGGTCTTTTTCCTTTAATAAAGCTACTGATCTTGCAAACAAACTCCCCAGACCTTTAGCACCATCTCCAGTGCCTAGATCACCCCTTAATCAGCCGAATCCAGTTTTATCCAAAGGGAAAGTAGACAAATTTGGTTTCACAAAGCCCTCTTTAACTGCTAGTGGCAACATTTTGCCAGTAGCCACAATAAAGAAGTCCCTATTACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41980
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126866 Essential Splice Site 520 814 3 11
Genomic Location (Zv9):
Chromosome 12 (position 14108581)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 12964234
GRCz11 12 13002537
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATGGGTCCTAGCTGCAATTCTGACTGTCTTTTCACATTTTATTTTATA[A/G]GGACATTCTCAACAAGCTTGAGAATGTGGAGTCATGTGACCTGGAAGATG
Long Flanking Sequence:
AATGTTATCTTTCCTAAACACACATTTTAGATGCCATTTATCAAACTTAAGTTAATGAACTGATTCTTTGTTGTTATGATACTGAATTTCGATACCAAACGGTACTTAAAAAAAAAAAATTAAAAAGTCAATTTTCCGCTAAGATTTGACTTTGTACTGAAAAACAGCTGAATTTGCCATTGTGTTTACATGCTCAACAGAAATGATTGCGATTGGCCATAAAGGTCACCGGTTTACTGATGACCTTCACCAATGTTTACCAAGTGCAAACACAGATACATAGACACTGGAGCATTTTAAAGCCCGAAGATCAGCTGCTCTGTCTATAAGCTGACGTATGAATGTCTAATTAACTAATGATGATTCGACTGATCTTTGCGGCTTTAAAACGCTACAAAAAAAAAAAAAAAAAAAAGTTGTAATTGCTAAATTGAGATCTACTGTTATAATGGATGGGTCCTAGCTGCAATTCTGACTGTCTTTTCACATTTTATTTTATA[A/G]GGACATTCTCAACAAGCTTGAGAATGTGGAGTCATGTGACCTGGAAGATGATGACCTCATGTTGGATTTGGACTTGTCTGTAGACGCATCATTTCACAGTGGTTAGTGGTGACATTGTTTTGTATTGCACTGTATTTTCTAATGATATATATAATATTTGACTTGAATAAAAAAAGAAATGGTAGAAAGTAGAAGTTCTGATAAATTAAAGACACATTACAGAATGTAACAACACAAGAAATTGAGCTAGAAGCTGAAACATATCTGTGTATAGTTTATGCTTGCAATGCTGGAAATATAGTTGTGCAAATTAAACACATAACGCAATGAGATTACAAACATATTTTAGACAAACTTTTAGACAGTACAAATGAATAATAGGTTTGACTTTCATGGCCACTTAATAATTAAACATTCTGCTCTGTAGTACCCTTTTTATAGACTGTCAGGTCTCACATTATATAAAGTGTCTTTAATTACTATATGAAAATGTAATTGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27910
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126866 Nonsense 560 814 4 11
Genomic Location (Zv9):
Chromosome 12 (position 14107978)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 12963631
GRCz11 12 13001934
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCTTGGTATTTTTATATTTGTTTTAGACACTGATGAAATGTCGTCTTA[T/G]GAATGGTCTGAAAAAGAAGGTCGGCCTACTCAGAGGAGGAGATGGCAACA
Long Flanking Sequence:
TTAGTGGTGACATTGTTTTGTATTGCACTGTATTTTCTAATGATATATATAATATTTGACTTGAATAAAAAAAGAAATGGTAGAAAGTAGAAGTTCTGATAAATTAAAGACACATTACAGAATGTAACAACACAAGAAATTGAGCTAGAAGCTGAAACATATCTGTGTATAGTTTATGCTTGCAATGCTGGAAATATAGTTGTGCAAATTAAACACATAACGCAATGAGATTACAAACATATTTTAGACAAACTTTTAGACAGTACAAATGAATAATAGGTTTGACTTTCATGGCCACTTAATAATTAAACATTCTGCTCTGTAGTACCCTTTTTATAGACTGTCAGGTCTCACATTATATAAAGTGTCTTTAATTACTATATGAAAATGTAATTGTTAGATGCATTGTAGTAAATCGTTCAATCACTGCAAATTCTGCATCTACAATTAGTTCTTGGTATTTTTATATTTGTTTTAGACACTGATGAAATGTCGTCTTA[T/G]GAATGGTCTGAAAAAGAAGGTCGGCCTACTCAGAGGAGGAGATGGCAACAACACCGGGGCATGTGTGAAAACAGGTGACCTTTTCATTCTGACATTTGGTGAAGTTGTTGTGAATTTTATGTCTGTACTTATCACAATATGTAAGAGCAAGCAAAGCATTGTTATATATTCTCGAGTTAGAATTACCATCCTTGTTGCAGAGGCTTCTGGCAGACCTGGTTCATGTTTTCTCTCTGTGTGACCTACAGAACTGGCCTTTTGCAGTCATTTGACGGGTTTAGGGGACATGGACTGGAGAGGTCAAGGTCAGACCATGTTACACTTGATGATTTGACACTGAATCTCGTGGCTCAAGACTGCTCTTCTGTCAAAGAACAACTGCTTCAACTGATGACACTGCTTCAGGTCAGACACAACCACATGGCAAATATATTCTAATCCATTTTTCAACTTAAAATTGTAAAACAAGTTCCTGCACAGACTTTTTTGAGTTAACCCCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27909
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126866 Nonsense 742 814 9 11
Genomic Location (Zv9):
Chromosome 12 (position 14077586)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 12933239
GRCz11 12 12971542
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCTTCCTTTGTACAGGGCATGTTGCTTGCCCCTGTCATCTCCTCTTGG[C/T]GACACTCACTGAAGGGGAGTGTTCGGCCATGTGCGCCACGTCACCATAGA
Long Flanking Sequence:
TTTCAGATTTTACCACATCCTCACCTTTTTATTTGTTCATCTTTTTTTTTTTTGGATTCTGTTTTTGTCTTATCTACTTTCTGGAACCTTTCTTCGCCGGACTCAATGTCCGTCATTATGGTCAACTTCTCTCTGCGTCTCAAGGCTGCCGACGGACATGGCGAGCTAACTGGACAAACTGGTAACAGTGGGAAAGCAGTCCACACAGAGGTGAGCAGTCAGCTGGTTAGTGCAAAAAGGAATGGCAACATACCATCTCGTAGCATTTGTTTTTAAAACGAAATGCTGCCATATGTTCTGCTGGCCAAATAATTCACAATCTCCAGAAATTGTGATCTCTAGAATAGGGCTACGTTTTCAGAATGAGCTTTTGTTGGATAGATAAGTGACTTTCATATTATAACTGTGTATTGGTATGTGCGTATTTGGTGCTGGGATCACCTTAATGTCTTTCTTCCTTTGTACAGGGCATGTTGCTTGCCCCTGTCATCTCCTCTTGG[C/T]GACACTCACTGAAGGGGAGTGTTCGGCCATGTGCGCCACGTCACCATAGACAGAGTGAGTCCTTAACTCAGACCAACCCAACCAGTTTGTGCATCAGCCCCAGTGCTTGCTGCATGTCCGCCTGCCTTCCCCTTGTGCACCCTTGTCATGCACACAAATCCCCCATCCAATCTTATTCCAGTGCCGAATCAGTCCATCATTTTTATTCCTTTTGGTTTCATTGTCCTAATGTCCCCTGTCTGCCAGCTTGATTAGAATCTGGAGACCAGTGGAGTTTGTCTGTATAGTCATTAAAGCCAGACAGTTATGATACTTACAAAGAATAATATTTTCATGTACTTGTTTTCATCGATCGTTTTTGACAGAACATTGAAGTTGTAGCCAATAGAATAGGATCCACTGTTTTCAATTCGATCTGTAACACTATACTTGAAGGGGGTGTTCGAGGCATTTAAAGTCATCAGTTACATCATGGCTGCATTTATATTGCATGGTTCAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27908
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126866 Essential Splice Site 759 814 9 11
Genomic Location (Zv9):
Chromosome 12 (position 14077531)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 12933184
GRCz11 12 12971487
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCACTGAAGGGGAGTGTTCGGCCATGTGCGCCACGTCACCATAGACAGA[G/A]TGAGTCCTTAACTCAGACCAACCCAACCAGTTTGTGCATCAGCCCCAGTG
Long Flanking Sequence:
ATTCTGTTTTTGTCTTATCTACTTTCTGGAACCTTTCTTCGCCGGACTCAATGTCCGTCATTATGGTCAACTTCTCTCTGCGTCTCAAGGCTGCCGACGGACATGGCGAGCTAACTGGACAAACTGGTAACAGTGGGAAAGCAGTCCACACAGAGGTGAGCAGTCAGCTGGTTAGTGCAAAAAGGAATGGCAACATACCATCTCGTAGCATTTGTTTTTAAAACGAAATGCTGCCATATGTTCTGCTGGCCAAATAATTCACAATCTCCAGAAATTGTGATCTCTAGAATAGGGCTACGTTTTCAGAATGAGCTTTTGTTGGATAGATAAGTGACTTTCATATTATAACTGTGTATTGGTATGTGCGTATTTGGTGCTGGGATCACCTTAATGTCTTTCTTCCTTTGTACAGGGCATGTTGCTTGCCCCTGTCATCTCCTCTTGGCGACACTCACTGAAGGGGAGTGTTCGGCCATGTGCGCCACGTCACCATAGACAGA[G/A]TGAGTCCTTAACTCAGACCAACCCAACCAGTTTGTGCATCAGCCCCAGTGCTTGCTGCATGTCCGCCTGCCTTCCCCTTGTGCACCCTTGTCATGCACACAAATCCCCCATCCAATCTTATTCCAGTGCCGAATCAGTCCATCATTTTTATTCCTTTTGGTTTCATTGTCCTAATGTCCCCTGTCTGCCAGCTTGATTAGAATCTGGAGACCAGTGGAGTTTGTCTGTATAGTCATTAAAGCCAGACAGTTATGATACTTACAAAGAATAATATTTTCATGTACTTGTTTTCATCGATCGTTTTTGACAGAACATTGAAGTTGTAGCCAATAGAATAGGATCCACTGTTTTCAATTCGATCTGTAACACTATACTTGAAGGGGGTGTTCGAGGCATTTAAAGTCATCAGTTACATCATGGCTGCATTTATATTGCATGGTTCAAGTGGCCCAATTCCGATTTTTTTTTTTCTAAGTGGCACAAATATGGCCCATGATACG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27907
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126866 Essential Splice Site 760 814 10 11
Genomic Location (Zv9):
Chromosome 12 (position 14074749)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 12930402
GRCz11 12 12968705
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTCTTTATTTCTTTATCTCCCTCTGCCTCTACCAAACTCTGGCAATA[G/T]GAGTGGAGCATCTAGTGCAATACTTCAGAGACACTGCGTGGTATAGTACT
Long Flanking Sequence:
GCATGACTTCAGAAGAAGCGTCTTGAAAGTGCTTGTGATGACTGCCAATACTGTCAGATGCAAGCTGTGGGAGACAAGTATTTGGAAAGAGAGTTGCTAGTTCATTACAGTACATCTTTTGATCTGGAATTGTGGGATCCCACAGAGAATGACGACAAATCTCTGACTCTTAGCACTGTGCTTACATTTAAAAGTCCAGATAAAACCCTTTATTCTGCCTATGTTTACAAGTGCTAATGAGCATGGAATTGAATGCACTTCCCTATATTTTTCTTTTTTGCTTTTGTTCATATGAAGCAAGAAATCTAAGGTTATGGCTGAATTGGCTACTTAATTTGTATTTTTTTTTTTTTTTGTTTAGTAATGCTGCAGTTCAAAAAGTGAGCCTTTTATGTTGTGCGTCTTCCTCTTCTACCTCTGTCATCTGTGTGTAAATCTGTCAATAACTGATTTTTCTTTATTTCTTTATCTCCCTCTGCCTCTACCAAACTCTGGCAATA[G/T]GAGTGGAGCATCTAGTGCAATACTTCAGAGACACTGCGTGGTATAGTACTGCCTGTCTTTTCTCTAAAACATTCTGTCATCCTTCCTGTTTTCTCTCTCTATCTGCATGATTTTGTGCTCTGTACTGCCAAGGTGGTCTACTTTCCTTTTCCAGCCTGATCTCACAAGGAAATGTAACTATTTTACATTTTGTCAGTTTAGGGGCTAATTTGTACAAGTTTAGTCATATGAAAGAGTACGAATTCAAAAAGGAGGCATGGCACCCAACCCTCGCCCCTAAACCCAACCGTCATTGGGGGATGAGCAAATTTTACTAAATTAGATGAATGAGATGTACGAATTCATGCGAATTAGCCACTAAATAAGTTAACTAATTTCTAACTAAAAAGTTACAAATTGCCATGAGATTGTTTGGGCCTTTCTATCTGTCTTTCTATCTGTTTATTCAACGCCTCTATATTTTTTGTAAAATCTGTGAAAACAATATGTTGTCAAATTTG
Associated Phenotype:
Not determined