Busch Lab

ZMP

si:dkey-22o12.2

Ensembl ID:
ENSDARG00000091513
ZFIN ID:
ZDB-GENE-060503-443
Description:
UPF0524 protein C3orf70 homolog A [Source:UniProtKB/Swiss-Prot;Acc:Q1LY84]
Human Orthologue:
C3orf70
Human Description:
chromosome 3 open reading frame 70 [Source:HGNC Symbol;Acc:33731]
Mouse Orthologue:
2510009E07Rik
Mouse Description:
RIKEN cDNA 2510009E07 gene Gene [Source:MGI Symbol;Acc:MGI:1919440]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa19516 Nonsense Available for shipment Available now
sa19515 Nonsense Available for shipment Available now
sa31209 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19516
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125759 Nonsense 64 269 2 2
Genomic Location (Zv9):
Chromosome 1 (position 29335468)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 29544083
GRCz11 1 30348014
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAATGTTTCTTCTTTTATTTTCCCCATCTTTGCAGGTAAATACGTCTAC[C/T]AACCTATGACCAGCGTATGCCAACTTCCCAGCACAGCGGTTCCAGTCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19515
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125759 Nonsense 198 269 2 2
Genomic Location (Zv9):
Chromosome 1 (position 29335065)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 29543680
GRCz11 1 30347611
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGAAGATCTCAGCCCCTAAAATGGACCACTGCTCCTCTCCCTCCAGCT[C/A]AGAGGACTCTGGAATCAATGCATTGGGTTTGCACTACATGGAATCATGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31209
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125759 Nonsense 246 269 2 2
Genomic Location (Zv9):
Chromosome 1 (position 29334922)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 29543537
GRCz11 1 30347468
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGATGAGCTGAGTACTGATGGAAACTCCAGCCCAGGTAGCTTCTGGGAC[C/T]AGGACGAGTGCACTTTACTATCACCATCTAAATCAATCGTTGAGATCATT
Associated Phenotype:
Not determined