Busch Lab

ZMP

si:ch211-214p13.9

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa34565 Nonsense Mutation detected in F1 DNA Not yet available
sa34564 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34565
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125429 Nonsense 226 321 4 7
ENSDART00000138996 None None 199 None 4
ENSDART00000146210 None None 89 None 3
Genomic Location (Zv9):
Chromosome 9 (position 9636992)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9437543
GRCz11 9 9415580
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCACAAACCCATCTATGTCCAGCCCTGTACAGTTAAACGCCACTCTATA[T/G]TCTTCAGCATCAGGTGAGGGACATAAGAATCTTTACATATTGGGGTCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34564
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125429 Essential Splice Site 231 321 4 7
ENSDART00000138996 None None 199 None 4
ENSDART00000146210 None None 89 None 3
Genomic Location (Zv9):
Chromosome 9 (position 9636977)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9437528
GRCz11 9 9415565
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTCCAGCCCTGTACAGTTAAACGCCACTCTATATTCTTCAGCATCAGG[T/C]GAGGGACATAAGAATCTTTACATATTGGGGTCAGGAGGTTCTGTTTTGGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5522
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125429 Essential Splice Site 270 321 6 7
ENSDART00000138996 None None 199 None 4
ENSDART00000146210 Essential Splice Site 38 89 2 3
Genomic Location (Zv9):
Chromosome 9 (position 9636198)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9436749
GRCz11 9 9414786
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCGCTTTGATGACTAATTAATTTAGTAATGACTTATCAATCTGTCCTTTT[A/C]GCACGTTGAAGATGCTTTGCTGCAAATCCAAAATCTCACCACCAGCTGAC
Associated Phenotype:
Not determined