Busch Lab

ZMP

ST18

Ensembl ID:
ENSDARG00000091410
Description:
suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein) [Source:HGNC Symbol;Acc:18
Human Orthologue:
ST18
Human Description:
suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein) [Source:HGNC Symbol;Acc:18
Mouse Orthologue:
St18
Mouse Description:
suppression of tumorigenicity 18 Gene [Source:MGI Symbol;Acc:MGI:2446700]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa14218 Nonsense Available for shipment Available now
sa37935 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14218
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127491 Nonsense 10 766 1 23
Genomic Location (Zv9):
Chromosome 24 (position 36615729)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35234644
GRCz11 24 35120909
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGGAGGCGTTTGGGGTCCYGGGCTGGTGGCCAGGCGTCTGGAGCTGGAC[C/T]GAGCTCGGCTGAACCTCAGTCTTCTAGAGCAGGCCATGGTGCTGCAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37935
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127491 Nonsense 44 766 1 23
Genomic Location (Zv9):
Chromosome 24 (position 36615832)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35234747
GRCz11 24 35121012
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACAGACAGGTTCTCCACAGTGCCTATAAAGATATGGACCGCTTCTTCT[T/A]GGAGCAGATGAATCACGAACGAAGGCAGCAGAGGATGATGGAGATGGATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30126
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127491 Essential Splice Site 508 766 17 23
Genomic Location (Zv9):
Chromosome 24 (position 36642221)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35261136
GRCz11 24 35147401
KASP Assay ID:
2261-8957.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGTGACGGCTCGGGTCATGTGACAGGAAACTATGCATCTCATAGGAGG[T/G]GAGTCTCATTAGACAAGAAGAAATCTCTTTAAAATAAATCTCTTTAAAGA
Associated Phenotype:
Not determined