Busch Lab

ZMP

COL13A1

Ensembl ID:
ENSDARG00000091398
Description:
collagen, type XIII, alpha 1 [Source:HGNC Symbol;Acc:2190]
Human Orthologue:
COL13A1
Human Description:
collagen, type XIII, alpha 1 [Source:HGNC Symbol;Acc:2190]
Mouse Orthologue:
Col13a1
Mouse Description:
collagen, type XIII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1277201]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa35417 Nonsense Mutation detected in F1 DNA Not yet available
sa14592 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7715
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040379 Essential Splice Site 86 620 8 42
Genomic Location (Zv9):
Chromosome 13 (position 7374582)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7679192
GRCz11 13 8011394
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTGCAAACCTTWNTTTTTCAGGGTGAACCTGGTCCAAAAGGAGAGAAGG[T/G]AAATWATTTATGAAYAATTGTTCTGTAGTTTATRAAACGGTCMAAGAKAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35417
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040379 Nonsense 216 620 18 42
Genomic Location (Zv9):
Chromosome 13 (position 7397100)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7701710
GRCz11 13 8033912
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGCTTTATTTTCTCGGTTTCTCTTCAGGGAATTAAAGGAGATGAAGGA[C/T]AGAAGGTAAGGAACACATTTGATTATTATTTTGTTGTTGTTGTTGTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14592
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040379 Nonsense 485 620 35 42
Genomic Location (Zv9):
Chromosome 13 (position 7433520)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7738130
GRCz11 13 8070332
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGAGRAACTAATTTGYAACTTTTTGTTTCTYATCAGGGMTCTCCAGGTT[T/A]GTCAGGACCAAAGGTTGGTATTCCTGCCCAAGCCCCTTTTATATTCCAGT
Associated Phenotype:
Not determined