Busch Lab

ZMP

MYO15A (2 of 3)

Ensembl ID:
ENSDARG00000091370
Description:
myosin XVA [Source:HGNC Symbol;Acc:7594]
Human Orthologue:
MYO15A
Human Description:
myosin XVA [Source:HGNC Symbol;Acc:7594]
Mouse Orthologue:
Myo15
Mouse Description:
myosin XV Gene [Source:MGI Symbol;Acc:MGI:1261811]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6910 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26131
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112551 Essential Splice Site 7 321 1 9
ENSDART00000112551 Essential Splice Site 7 321 1 9
Genomic Location (Zv9):
Chromosome 3 (position 40119551)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39982911
GRCz11 3 40124769
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGATAACTCCAGTCGATTTGGGAAATATATGGAAATATTTATGGAAGAG[T/G]AAGTTCACCTTCGAGTCAAATCTCTACTGATTTGTGCACTCATTTACAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2143
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112551 Essential Splice Site 7 321 1 9
ENSDART00000112551 Essential Splice Site 7 321 1 9
Genomic Location (Zv9):
Chromosome 3 (position 40119551)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39982911
GRCz11 3 40124769
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGATAACTCCAGTCGATTTGGGAAATATATGGAAATATTTATGGAAGAG[T/A]AAGTTCACCTTCGAGTCAAATCTCTACTGAWTTGTGCACTCATTTACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6910
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112551 Essential Splice Site 251 321 8 9
Genomic Location (Zv9):
Chromosome 3 (position 40106188)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39969548
GRCz11 3 40111406
KASP Assay ID:
554-4647.1 (used for ordering genotyping assays)
KASP Sequence:
TGAGTACCTTCAGTTCTTTTTCAACAGGGTCATTTTCAAAGAAGAACAAG[T/A]AAGCTGTCTCTGTTCACTCTAATCCTCTGATGAGAGCGATAAAGCCTGTG
Associated Phenotype:
Not determined