Busch Lab

ZMP

LOC100334628

Ensembl ID:
ENSDARG00000091326
Human Orthologue:
CEP120
Human Description:
centrosomal protein 120kDa [Source:HGNC Symbol;Acc:26690]
Mouse Orthologue:
Cep120
Mouse Description:
centrosomal protein 120 Gene [Source:MGI Symbol;Acc:MGI:2147298]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa21164 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21164
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122378 Nonsense 461 884 9 17
Genomic Location (Zv9):
Chromosome 8 (position 108962)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 80121
GRCz11 8 258944
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTACTAAGTAAATGTGTGTGTGTTTTCAGATGTTCCCGATGTGCTCGTA[C/T]GAACTGAAGCTGACGCCGCAGACTCTTCCGTCTCTGTTTCTGCCCCAAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27117
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122378 Nonsense 568 884 11 17
Genomic Location (Zv9):
Chromosome 8 (position 111960)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 83119
GRCz11 8 261942
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAATGTGTGTGTGTTTGTGTGTTCAGGGTTCCTCTGCTGGTGGAGATGT[G/A]GCACCGAGAGCCGGGTTCTGGAGATGTTCTGCTGGGTTCAGTCAGTATTC
Associated Phenotype:
Not determined