Busch Lab

ZMP

si:rp71-39b20.3

Ensembl ID:
ENSDARG00000091306
ZFIN ID:
ZDB-GENE-070912-703
Description:
small conductance calcium-activated potassium channel protein 1 [Source:RefSeq peptide;Acc:NP_00112
Human Orthologue:
KCNN1
Human Description:
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1 [Source:HG
Mouse Orthologue:
Kcnn1
Mouse Description:
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1 Gene [Sour

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa19745 Nonsense Available for shipment Available now
sa6838 Nonsense Mutation detected in F1 DNA Not yet available
sa11915 Nonsense Available for shipment Available now
sa12321 Nonsense Available for shipment Available now
sa13213 Nonsense Available for shipment Available now
sa32910 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa19745
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033922 Nonsense 12 890 1 9
ENSDART00000135104 None None 538 None 8
ENSDART00000147885 None None 261 None 4
Genomic Location (Zv9):
Chromosome 2 (position 23401978)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24806517
GRCz11 2 24462168
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGCGGATATTGAGGGGATGCGGCATCGGCACGCGGGAGCTGTCCACCAG[C/T]AGCACAGCAACGACGCGGACGCTCGTGACAGTCCAAAAGAAGCATCTTGT
Long Flanking Sequence:
CTGGCTAGTTTAGTCTTCCTGTAGGTACTGAATGTGCGCGTATGATATTGCTTTATTGTCTTCAACTCATCACATTACGCCATCACAAAATAAGCCATTTCTTCCAGCGGTGCACCTGTTCCGCAAGTATTTGATTTGATGCTGTTTTTATTTTTATTTTTTGTAATCGACCTGCAATGGCACAGGCTTGAAAATGTCAATCCTGCCAGGACATTGAGCTTTCGACGCGCGCATGACCTTGCTAATACCCAATTCGCATCTCAGGTTTAATCTTATCCACTGTAAACATAAAGCGGTTTTCACACGAGGGCGGCGTTCATCTCGGCGATGACGTCACGAGGCAGGTCTCGCTCGAGTCCACCAATGAGACGAGGCAGCTCGGTTCTTTTGGGGCACATCGCAATGAATGGGTGTCGGTGCTTTACAAGGCAAAGGAGCAACCACAACAAGACGCGGATATTGAGGGGATGCGGCATCGGCACGCGGGAGCTGTCCACCAG[C/T]AGCACAGCAACGACGCGGACGCTCGTGACAGTCCAAAAGAAGCATCTTGTCCAGTCGCCCCGCTCTTTAGTCTGCCGCCCCCACCGCCATCGATAAAGGAGCGATCCACCTCCTCACATAACAACCGACATGTACAGTCCTGTCCGGACCGCGGCACCAGGAACGACGAGTGCCTGCCTTTGACCGGCCACTGCAGCCTCGCGCAGGGAGCGCGCACCGACCGTCAGCCTTACGACAACCTGCCGCATCCGTTTCCAGGGGCCTCATCTGGCTATCAGTGTCATTCAGAGGGGAGCCATTCTCCTCAGCAGAGATCTTCCGTTTCCCCGCAGCCCTCCCCATCTGAACTGCTGCCGCCGCCTCTGCCTTCGCACATTTCTAATACGCGGGATACGCGCCAAAAGAGTGCTAATTACAAACAAGACATCGTACAGCGTCGCGTCGGGGAGGGGGGGCGTCGAGACCAATACCAGTTGCTGCAGCAACCTTGTTATAATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6838
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033922 Nonsense 76 890 1 9
ENSDART00000135104 None None 538 None 8
ENSDART00000147885 None None 261 None 4
Genomic Location (Zv9):
Chromosome 2 (position 23402172)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24806323
GRCz11 2 24461974
KASP Assay ID:
554-4665.1 (used for ordering genotyping assays)
KASP Sequence:
CCGGACCGCGGCACCAGGAACGACGAGTGCCTGCCTTTGACCGGCCACTG[C/A]AGCCTCGCGCAGGGAGCGCGCACCGACCGTCAGCCTTACGACAACCTGCC
Long Flanking Sequence:
TGTCAATCCTGCCAGGACATTGAGCTTTCGACGCGCGCATGACCTTGCTAATACCCAATTCGCATCTCAGGTTTAATCTTATCCACTGTAAACATAAAGCGGTTTTCACACGAGGGCGGCGTTCATCTCGGCGATGACGTCACGAGGCAGGTCTCGCTCGAGTCCACCAATGAGACGAGGCAGCTCGGTTCTTTTGGGGCACATCGCAATGAATGGGTGTCGGTGCTTTACAAGGCAAAGGAGCAACCACAACAAGACGCGGATATTGAGGGGATGCGGCATCGGCACGCGGGAGCTGTCCACCAGCAGCACAGCAACGACGCGGACGCTCGTGACAGTCCAAAAGAAGCATCTTGTCCAGTCGCCCCGCTCTTTAGTCTGCCGCCCCCACCGCCATCGATAAAGGAGCGATCCACCTCCTCACATAACAACCGACATGTACAGTCCTGTCCGGACCGCGGCACCAGGAACGACGAGTGCCTGCCTTTGACCGGCCACTG[C/A]AGCCTCGCGCAGGGAGCGCGCACCGACCGTCAGCCTTACGACAACCTGCCGCATCCGTTTCCAGGGGCCTCATCTGGCTATCAGTGTCATTCAGAGGGGAGCCATTCTCCTCAGCAGAGATCTTCCGTTTCCCCGCAGCCCTCCCCATCTGAACTGCTGCCGCCGCCTCTGCCTTCGCACATTTCTAATACGCGGGATACGCGCCAAAAGAGTGCTAATTACAAACAAGACATCGTACAGCGTCGCGTCGGGGAGGGGGGGCGTCGAGACCAATACCAGTTGCTGCAGCAACCTTGTTATAATCAACAAAGGGACCCCTCCTTTAAGCCACTCTTGCCAAACTCTAGTCAAGGACACGTAAATGAGCGCGAGGAAGCCGAGAAGGAGAGGCAATTAATTGAGCCTCAGGCTCAGTTACTGTTGGGCAGCAGCTTGCCGATCAACTACTGCATCGGCGGATCGGGGCAAGTGTGCAGAAACAAGCAGGCGCCGCTGTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11915
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033922 Nonsense 169 890 1 9
ENSDART00000135104 None None 538 None 8
ENSDART00000147885 None None 261 None 4
ENSDART00000033922 Nonsense 169 890 1 9
ENSDART00000135104 None None 538 None 8
ENSDART00000147885 None None 261 None 4
Genomic Location (Zv9):
Chromosome 2 (position 23402449)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24806046
GRCz11 2 24461697
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGACATCGTACAGCGTCGCGTCGGGGAGGGGGGGCGTCGAGACCAATAC[C/T]AGTTGCTGCAGCAACCTTGTTATAATCAAYAAAGGGACCCCTCCTTTRAG
Long Flanking Sequence:
GGCATCGGCACGCGGGAGCTGTCCACCAGCAGCACAGCAACGACGCGGACGCTCGTGACAGTCCAAAAGAAGCATCTTGTCCAGTCGCCCCGCTCTTTAGTCTGCCGCCCCCACCGCCATCGATAAAGGAGCGATCCACCTCCTCACATAACAACCGACATGTACAGTCCTGTCCGGACCGCGGCACCAGGAACGACGAGTGCCTGCCTTTGACCGGCCACTGCAGCCTCGCGCAGGGAGCGCGCACCGACCGTCAGCCTTACGACAACCTGCCGCATCCGTTTCCAGGGGCCTCATCTGGCTATCAGTGTCATTCAGAGGGGAGCCATTCTCCTCAGCAGAGATCTTCCGTTTCCCCGCAGCCCTCCCCATCTGAACTGCTGCCGCCGCCTCTGCCTTCGCACATTTCTAATACGCGGGATACGCGCCAAAAGAGTGCTAATTACAAACAAGACATCGTACAGCGTCGCGTCGGGGAGGGGGGGCGTCGAGACCAATAC[C/T]AGTTGCTGCAGCAACCTTGTTATAATCAACAAAGGGACCCCTCCTTTAAGCCACTCTTGCCAAACTCTAGTCAAGGACACGTAAATGAGCGCGAGGAAGCCGAGAAGGAGAGGCAATTAATTGAGCCTCAGGCTCAGTTACTGTTGGGCAGCAGCTTGCCGATCAACTACTGCATCGGCGGATCGGGGCAAGTGTGCAGAAACAAGCAGGCGCCGCTGTTGCAGCATCAGCATCAGCAGGCTCGCGCGCAGGAGCACAGCCTCCAGCAGCAGCACAGTGACCGAGACAGCAGGTACCAGGAGGGGAAAATCGCGCTCTGTCAGCCGTATCGATGCGAGCGCGCGCTGGAGAGAAACTCGTCCGTGTCTAGTAGTGAAGCCAGCAGCCCCCCGTACGGCTCCAGCAGTCAACTGTGGCCAGAGCCCCACGACAAGGAGGAGAAGAAAAATCGGGCTGGCAAACACAAGGTATTTATGTATGGACAGCAGCACAGCTTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12321
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033922 Nonsense 169 890 1 9
ENSDART00000135104 None None 538 None 8
ENSDART00000147885 None None 261 None 4
ENSDART00000033922 Nonsense 169 890 1 9
ENSDART00000135104 None None 538 None 8
ENSDART00000147885 None None 261 None 4
Genomic Location (Zv9):
Chromosome 2 (position 23402449)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24806046
GRCz11 2 24461697
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGACATCGTACAGCGTCGCGTCGGGGAGGGGGGGCGTCGAGACCAATAC[C/T]AGTTGCTGCAGCAACCTTGTTATAATCAAYAAAGGGACCCCTCCTTTRAG
Long Flanking Sequence:
GGCATCGGCACGCGGGAGCTGTCCACCAGCAGCACAGCAACGACGCGGACGCTCGTGACAGTCCAAAAGAAGCATCTTGTCCAGTCGCCCCGCTCTTTAGTCTGCCGCCCCCACCGCCATCGATAAAGGAGCGATCCACCTCCTCACATAACAACCGACATGTACAGTCCTGTCCGGACCGCGGCACCAGGAACGACGAGTGCCTGCCTTTGACCGGCCACTGCAGCCTCGCGCAGGGAGCGCGCACCGACCGTCAGCCTTACGACAACCTGCCGCATCCGTTTCCAGGGGCCTCATCTGGCTATCAGTGTCATTCAGAGGGGAGCCATTCTCCTCAGCAGAGATCTTCCGTTTCCCCGCAGCCCTCCCCATCTGAACTGCTGCCGCCGCCTCTGCCTTCGCACATTTCTAATACGCGGGATACGCGCCAAAAGAGTGCTAATTACAAACAAGACATCGTACAGCGTCGCGTCGGGGAGGGGGGGCGTCGAGACCAATAC[C/T]AGTTGCTGCAGCAACCTTGTTATAATCAACAAAGGGACCCCTCCTTTAAGCCACTCTTGCCAAACTCTAGTCAAGGACACGTAAATGAGCGCGAGGAAGCCGAGAAGGAGAGGCAATTAATTGAGCCTCAGGCTCAGTTACTGTTGGGCAGCAGCTTGCCGATCAACTACTGCATCGGCGGATCGGGGCAAGTGTGCAGAAACAAGCAGGCGCCGCTGTTGCAGCATCAGCATCAGCAGGCTCGCGCGCAGGAGCACAGCCTCCAGCAGCAGCACAGTGACCGAGACAGCAGGTACCAGGAGGGGAAAATCGCGCTCTGTCAGCCGTATCGATGCGAGCGCGCGCTGGAGAGAAACTCGTCCGTGTCTAGTAGTGAAGCCAGCAGCCCCCCGTACGGCTCCAGCAGTCAACTGTGGCCAGAGCCCCACGACAAGGAGGAGAAGAAAAATCGGGCTGGCAAACACAAGGTATTTATGTATGGACAGCAGCACAGCTTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13213
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033922 Nonsense 179 890 1 9
ENSDART00000135104 None None 538 None 8
ENSDART00000147885 None None 261 None 4
Genomic Location (Zv9):
Chromosome 2 (position 23402479)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24806016
GRCz11 2 24461667
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGGGCGTCGAGACCAATACYAGTTGCTGCAGCAACCTTGTTATAATCAA[C/T]AAAGGGACCCCTCCTTTRAGCCACTCTTGCCAAACTCTAGTCAAGGACAC
Long Flanking Sequence:
AGCACAGCAACGACGCGGACGCTCGTGACAGTCCAAAAGAAGCATCTTGTCCAGTCGCCCCGCTCTTTAGTCTGCCGCCCCCACCGCCATCGATAAAGGAGCGATCCACCTCCTCACATAACAACCGACATGTACAGTCCTGTCCGGACCGCGGCACCAGGAACGACGAGTGCCTGCCTTTGACCGGCCACTGCAGCCTCGCGCAGGGAGCGCGCACCGACCGTCAGCCTTACGACAACCTGCCGCATCCGTTTCCAGGGGCCTCATCTGGCTATCAGTGTCATTCAGAGGGGAGCCATTCTCCTCAGCAGAGATCTTCCGTTTCCCCGCAGCCCTCCCCATCTGAACTGCTGCCGCCGCCTCTGCCTTCGCACATTTCTAATACGCGGGATACGCGCCAAAAGAGTGCTAATTACAAACAAGACATCGTACAGCGTCGCGTCGGGGAGGGGGGGCGTCGAGACCAATACCAGTTGCTGCAGCAACCTTGTTATAATCAA[C/T]AAAGGGACCCCTCCTTTAAGCCACTCTTGCCAAACTCTAGTCAAGGACACGTAAATGAGCGCGAGGAAGCCGAGAAGGAGAGGCAATTAATTGAGCCTCAGGCTCAGTTACTGTTGGGCAGCAGCTTGCCGATCAACTACTGCATCGGCGGATCGGGGCAAGTGTGCAGAAACAAGCAGGCGCCGCTGTTGCAGCATCAGCATCAGCAGGCTCGCGCGCAGGAGCACAGCCTCCAGCAGCAGCACAGTGACCGAGACAGCAGGTACCAGGAGGGGAAAATCGCGCTCTGTCAGCCGTATCGATGCGAGCGCGCGCTGGAGAGAAACTCGTCCGTGTCTAGTAGTGAAGCCAGCAGCCCCCCGTACGGCTCCAGCAGTCAACTGTGGCCAGAGCCCCACGACAAGGAGGAGAAGAAAAATCGGGCTGGCAAACACAAGGTATTTATGTATGGACAGCAGCACAGCTTTCAAATGTCACTCAAATGTATAGAATGCGCTGCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5137
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033922 Nonsense 179 890 1 9
ENSDART00000135104 None None 538 None 8
ENSDART00000147885 None None 261 None 4
Genomic Location (Zv9):
Chromosome 2 (position 23402479)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24806016
GRCz11 2 24461667
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGGGCGTCGAGACCAATACCAGTTGCTGCAGCAACCTTGTTATAATCAA[C/T]AAAGGGACCCCTCCTTTAAGCCACTCTTGCCAAACTCTAGTCAAGGACAC
Long Flanking Sequence:
AGCACAGCAACGACGCGGACGCTCGTGACAGTCCAAAAGAAGCATCTTGTCCAGTCGCCCCGCTCTTTAGTCTGCCGCCCCCACCGCCATCGATAAAGGAGCGATCCACCTCCTCACATAACAACCGACATGTACAGTCCTGTCCGGACCGCGGCACCAGGAACGACGAGTGCCTGCCTTTGACCGGCCACTGCAGCCTCGCGCAGGGAGCGCGCACCGACCGTCAGCCTTACGACAACCTGCCGCATCCGTTTCCAGGGGCCTCATCTGGCTATCAGTGTCATTCAGAGGGGAGCCATTCTCCTCAGCAGAGATCTTCCGTTTCCCCGCAGCCCTCCCCATCTGAACTGCTGCCGCCGCCTCTGCCTTCGCACATTTCTAATACGCGGGATACGCGCCAAAAGAGTGCTAATTACAAACAAGACATCGTACAGCGTCGCGTCGGGGAGGGGGGGCGTCGAGACCAATACCAGTTGCTGCAGCAACCTTGTTATAATCAA[C/T]AAAGGGACCCCTCCTTTAAGCCACTCTTGCCAAACTCTAGTCAAGGACACGTAAATGAGCGCGAGGAAGCCGAGAAGGAGAGGCAATTAATTGAGCCTCAGGCTCAGTTACTGTTGGGCAGCAGCTTGCCGATCAACTACTGCATCGGCGGATCGGGGCAAGTGTGCAGAAACAAGCAGGCGCCGCTGTTGCAGCATCAGCATCAGCAGGCTCGCGCGCAGGAGCACAGCCTCCAGCAGCAGCACAGTGACCGAGACAGCAGGTACCAGGAGGGGAAAATCGCGCTCTGTCAGCCGTATCGATGCGAGCGCGCGCTGGAGAGAAACTCGTCCGTGTCTAGTAGTGAAGCCAGCAGCCCCCCGTACGGCTCCAGCAGTCAACTGTGGCCAGAGCCCCACGACAAGGAGGAGAAGAAAAATCGGGCTGGCAAACACAAGGTATTTATGTATGGACAGCAGCACAGCTTTCAAATGTCACTCAAATGTATAGAATGCGCTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32910
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033922 Nonsense 523 890 4 9
ENSDART00000135104 Nonsense 171 538 3 8
ENSDART00000147885 Nonsense 135 261 3 4
Genomic Location (Zv9):
Chromosome 2 (position 23431395)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24777100
GRCz11 2 24432751
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTTCATGGTGGACAATGGTGCGGATGACTGGAGGATAGCCATGACATA[C/A]GAGCGCATCTTTTTCATTGTCCTGGAGCTGTTGGTGTGTGCCATTCACCC
Long Flanking Sequence:
GGTCTGTATATGCGTGGTGAATGCATGTAACCTGAAGCGTTTGTGATCTCACTAGCCCAGATGTATTTTTTGTAGTCACCAAAACTTCGTTCGCTGTAGGCTTTTCTAAGCTAACTCTGTAAAGGCAAATGTCTCCCTTTGCATTGAATTTTGAGCGTCTTACATTCAGAGATGTTGTTAATGTTCACACAGCTACGTTACACATCAACTAAAGTTTAAAATATGATATCATAGTGGACCACCCCTTTAAACAATTTCTATTTTCAAACAACGTTTACACAGGAATCAACCTGTTTTTATCATACCAAAAACAGAAATACAAGAAAGGTTTTAGTAAAAGGAAAACTTTCTTTGCACACTTCACTTTTAAACCATCACTTGGCAATGCTTCCTCTTATTTGTGTTTTCCTTTTGCCAAATAACCTCTTGCTCTCTGCCTGCTCCCTGCAGCTGTTCATGGTGGACAATGGTGCGGATGACTGGAGGATAGCCATGACATA[C/A]GAGCGCATCTTTTTCATTGTCCTGGAGCTGTTGGTGTGTGCCATTCACCCCATCCCGGGCCAGTACGTATTCACATGGACGGCCCGGCTGGCTTTCACCTACGTGCCCTCCGTGGCCGACGCCGACGTAGACATCATCCTCTCCATCCCCATGTTCCTTCGCCTCTACCTGATAGGCCGGGTTATGCTCCTTCATAGCAAACTGTTCACGGACGCATCTTCACGCAGTATAGGTGCCCTCAACAAGATCAACTTCAACACACGCTTCGTGATGAAGACCCTCATGACCATCTGTCCGGGCACCGTGCTGCTGGTCTTCAGCATCTCCTCCTGGATCATCGCGGCCTGGACCGTGCGGGTCTGTGAGAGGTATGGCACCACGGAGAGTGTGATCCCGAGCTACACAGCTATTCCCTTCCCCTCCACTCGTCCTCTCTCTCTCGCTCTCTCGCTCTCTTCCTCTGTCTCTCGCTCTCTTTCTCTCTGCATCTCCCACTCACT
Associated Phenotype:
Not determined