Busch Lab

ZMP

si:ch211-225g23.1

Ensembl ID:
ENSDARG00000091271
ZFIN ID:
ZDB-GENE-030131-3256
Human Orthologue:
CENPT
Human Description:
centromere protein T [Source:HGNC Symbol;Acc:25787]
Mouse Orthologue:
Cenpt
Mouse Description:
centromere protein T Gene [Source:MGI Symbol;Acc:MGI:2443939]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa13926 Essential Splice Site Available for shipment Available now
sa44953 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43579 Nonsense Mutation detected in F1 DNA Not yet available
sa7488 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29510
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130651 Nonsense 53 891 2 14
ENSDART00000136539 Nonsense 53 914 2 13
ENSDART00000138600 Nonsense 35 146 2 5
Genomic Location (Zv9):
Chromosome 21 (position 6356090)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 6294426
GRCz11 21 6399934
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGTGCTAGGATGAAACATGCCGCTGGATTGGAGAGTCCTGGATCTGCCT[T/A]GCGTCACAGACTCAAGAAGAAACTCCATGAGGTAAATCATGTGGTGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13926
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130651 Essential Splice Site 142 891 4 14
ENSDART00000136539 Essential Splice Site 142 914 4 13
ENSDART00000138600 Essential Splice Site 124 146 4 5
Genomic Location (Zv9):
Chromosome 21 (position 6359203)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 6297539
GRCz11 21 6403047
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATCAGAACSGAATCCAGAGACCAGTGTGTCCAGTGCTGGGGAAAGAACG[T/C]TAGYACCTCTTCATTCCCATGTACCCTCACTAGTTCTATACATGTCGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44953
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130651 Essential Splice Site 272 891 7 14
ENSDART00000136539 Essential Splice Site 272 914 7 13
ENSDART00000138600 None None 146 None 5
Genomic Location (Zv9):
Chromosome 21 (position 6362176)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 6300512
GRCz11 21 6406020
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCGTTTGATGAGGCCGTTCAGAGATGCTTGGAGCAGGGTCCTAACCAAG[G/A]TTTCTATACTTAATGTTTTTGTGTAATTTATGTTTTGTAAAATGAATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43579
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130651 Nonsense 808 891 12 14
ENSDART00000136539 Nonsense 831 914 11 13
ENSDART00000138600 None None 146 None 5
Genomic Location (Zv9):
Chromosome 21 (position 6372210)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 6310546
GRCz11 21 6416054
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGAGCATCTTCAAGCACTTCGCCAAGACCAAGGTGGCCAGTGACGTCTA[T/A]CCTGTCATTAATGAGATGTAAGAACTTGTGGAAGGATTATTTACATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7488
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130651 Missense 818 891 13 14
ENSDART00000136539 Missense 841 914 12 13
ENSDART00000138600 None None 146 None 5
Genomic Location (Zv9):
Chromosome 21 (position 6373730)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 6312066
GRCz11 21 6417574
KASP Assay ID:
554-4139.1 (used for ordering genotyping assays)
KASP Sequence:
ATRTCTCCTGCAATGTCNNNNNNTGTTTGTTTTCTSTTTCACTCAGTCTG[T/A]AGAAGWACTTTGACCGGTTGGCTGATGATCTAGAAACATACGCWACTCATGCCAAA
Associated Phenotype:
Not determined