Busch Lab

ZMP

SMYD1 (2 of 3)

Ensembl ID:
ENSDARG00000091253
Description:
SET and MYND domain containing 1 [Source:HGNC Symbol;Acc:20986]
Human Orthologue:
SMYD1
Human Description:
SET and MYND domain containing 1 [Source:HGNC Symbol;Acc:20986]
Mouse Orthologue:
Smyd1
Mouse Description:
SET and MYND domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:104790]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa15678 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15678
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067093 Nonsense 182 214 4 4
Genomic Location (Zv9):
Chromosome 8 (position 1106804)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 972392
GRCz11 8 1038135
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGCTCTTTCTGTGTGTCAGATCAACTGTAAYGGGTTCATGGTGAGCGAT[C/T]AGCGCGGCCTGCAGGYGGTCGGTGTGGGGTTATTTCCCAATCTGTGTTTG
Associated Phenotype:
Not determined