Busch Lab

ZMP

GLT1D1

Ensembl ID:
ENSDARG00000091241
Description:
glycosyltransferase 1 domain containing 1 [Source:HGNC Symbol;Acc:26483]
Human Orthologue:
GLT1D1
Human Description:
glycosyltransferase 1 domain containing 1 [Source:HGNC Symbol;Acc:26483]
Mouse Orthologue:
Glt1d1
Mouse Description:
glycosyltransferase 1 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2442755]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa34451 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa31668 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34451
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129357 Essential Splice Site 126 309 4 13
Genomic Location (Zv9):
Chromosome 8 (position 37390282)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36246429
GRCz11 8 35975777
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGTGGCATTCACTGATGCACTGAAAGAACAGGCTGAGATGCTCCTGG[T/C]AAGACATGTTGTGTTTACCACTGCCATTTCTATCAAATTGTGTTTTTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31668
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129357 Nonsense 183 309 8 13
Genomic Location (Zv9):
Chromosome 8 (position 37429223)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36285370
GRCz11 8 36014718
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGTTTTTCTGCTGGTGTGTGGACTCAGACGAGTTAAAGATCCTTTGTA[T/A]CTTGTTGAAGCATTTTCAGGTATTGGTGTTTTGGAAAATCACAGCTCTTC
Associated Phenotype:
Not determined