Busch Lab

ZMP

PARD3 (2 of 2)

Ensembl ID:
ENSDARG00000091238
Description:
par-3 partitioning defective 3 homolog (C. elegans) [Source:HGNC Symbol;Acc:16051]
Human Orthologue:
PARD3
Human Description:
par-3 partitioning defective 3 homolog (C. elegans) [Source:HGNC Symbol;Acc:16051]
Mouse Orthologue:
Pard3
Mouse Description:
par-3 (partitioning defective 3) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2135608]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa45815 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44068 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45815
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123770 Essential Splice Site 107 521 2 10
Genomic Location (Zv9):
Chromosome 24 (position 2003155)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 1979715
GRCz11 24 1975759
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATACTCCAAGAAGATCGGCCGAAAGTTCAGCGTCCAGCTGCGGAAAGG[T/C]GAGATTGGGTTTGATATGAGGAAATGTGTCCATGTCAGATCTGGCTGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44068
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123770 Nonsense 507 521 10 10
Genomic Location (Zv9):
Chromosome 24 (position 1880696)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 1857256
GRCz11 24 1853300
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGCCACCGGTCAGGGACACACACTCCATACTAACCTCAATTCACACTGT[A/T]AAACACACAGACTCTGGAGATCTGGTGCAAGAGCTGGGTGTAGCTAACAC
Associated Phenotype:
Not determined