Busch Lab

ZMP

ENSDARG00000091233

Ensembl ID:
ENSDARG00000091233
Mouse Orthologues:
Tcrb-C1, Tcrb-C2
Mouse Descriptions:
T-cell receptor beta, constant region 1 Gene [Source:MGI Symbol;Acc:MGI:4439726]
T-cell receptor beta, constant region 2 Gene [Source:MGI Symbol;Acc:MGI:4835227]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36521 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28928
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122327 Essential Splice Site 23 179 2 5
Genomic Location (Zv9):
Chromosome 17 (position 48648139)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 48411119
GRCz11 17 48493748
KASP Assay ID:
2261-1551.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGTAACTGAATTTTGTATTGTGACTCTGACGTTTGCCTCATTGTTTTAC[A/T]GATCCTTTAATTCCCAAGAGTGAACCATCCGTAAAGATTCTAAATGCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36521
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122327 Nonsense 105 179 2 5
Genomic Location (Zv9):
Chromosome 17 (position 48647892)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 48410872
GRCz11 17 48493501
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAAAAAGTACACCATATCCAGCAGACTAAAAGTCTCTCAGAAGATGTGG[A/T]AAAAATCAACAAACAAATTCACCTGTATAGTGTCCTATTACAATGGATCT
Associated Phenotype:
Not determined