Busch Lab

ZMP

si:dkey-192p21.6

Ensembl ID:
ENSDARG00000091212
ZFIN ID:
ZDB-GENE-060503-809
Description:
hypothetical protein LOC565246 [Source:RefSeq peptide;Acc:NP_001139059]
Human Orthologue:
HGSNAT
Human Description:
heparan-alpha-glucosaminide N-acetyltransferase [Source:HGNC Symbol;Acc:26527]
Mouse Orthologue:
Hgsnat
Mouse Description:
heparan-alpha-glucosaminide N-acetyltransferase Gene [Source:MGI Symbol;Acc:MGI:1196297]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa35493 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35493
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112547 Essential Splice Site 219 340 6 9
ENSDART00000113390 None None 211 None 7
ENSDART00000135383 Essential Splice Site 461 582 15 18
ENSDART00000142404 None None 205 None 9
ENSDART00000146487 None None 205 None 9
Genomic Location (Zv9):
Chromosome 13 (position 25883133)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25528793
GRCz11 13 25659243
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGAATAAAGGTATCCTGGCGCGATTCCTGGTTTGGGCTTTAATCCTGG[T/A]ATGTTCACTCAAACACACACCACACACACACACTCAGTTAAAGTTCATTT
Long Flanking Sequence:
AAACCCAGTCGCATTGCTCAAATCCCTGTAGGCGGAGGCAAAAAACAGTTAGCAGCAAGTCCGTCAATCAGCATGTGTTTGGGAAGACGGCAGGTGTCCGTTCACTCCAGCGTCCTCGGCTGAGGCTCATTCGTCATCACCGAATTAATCAGTGAGCACCGCCAACTTCACAGCCGTGCGAGAAACATGAGCTCAGTTTCAGGGCCACAACCAGCGCTCACATCCTCTCTGTGTCTCTCTTTCTCTGGGCCAAACATGATATAAGCATGACGTATCATTAGCATTACTGTCTATTAGCTTTTAATTAATTACGTTTTCTTAGAGGATTGTGATCCATTTGGCCAAAAGTGAAAGCCTGGTCTACATAATGTTGCTCTCTGAATAGGAAAAGTATTTAAGATGTAATCTTTTGTGTCCGCAGGCCGGAAAGATTCTTCTGTTTTTTCGTCAGATGAATAAAGGTATCCTGGCGCGATTCCTGGTTTGGGCTTTAATCCTGG[T/A]ATGTTCACTCAAACACACACCACACACACACACTCAGTTAAAGTTCATTTTAAGTGTGTTAACTATGGCAAACAGCATGGCTCTGTATGTACAAGTGTTAAATTGCTTGTAGTTGCAGACAGTTTATGAAATAGGTAGACGTCATGTGATATGCGTATGTATATGTGGTCAATGAATTCCAAGGCAGAGATTGCTATCAACACGCCTCTCGGGACTGAACCGGATGGCCTGTTCGGCTCATGGATGTCTGGTGGTTTTTGAGTTTAGACTTTTGCCGCTGTTGTTGCATATTCATTTCCACTGGTTCTTTAGTTTAATATGTAGCATAGAAATGAGGTAAGCTGATAAACTTAATGTGTTTTATAGGATGTTTTAACATGTTAGCCAGCACGCACTTTTGTAGATTTACACCTACACTCTCAAAAATAAATGAAAAGGGAGCTGTCACTGGGGTGGTACCTTTTCAAAAGGTACACATTTGTACTTAAAAGGTCCATATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3837
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112547 Essential Splice Site 243 340 7 9
ENSDART00000113390 None None 211 None 7
ENSDART00000135383 Essential Splice Site 485 582 16 18
ENSDART00000142404 None None 205 None 9
ENSDART00000146487 None None 205 None 9
Genomic Location (Zv9):
Chromosome 13 (position 25871278)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25516938
GRCz11 13 25647388
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTAAGTGCACAAGAGACGAAGGATTTATACCTGTCAATAAAAACCTTTGG[T/C]AAGTGCTTCCTGACCCTCTAAATCCAGCCACTGTTTTCGCCTTCCACCAA
Long Flanking Sequence:
TTTCAAATATAGTTTTAGTTTTGTATATTGAGTTAGAATTAGAGTTTTCATTTTAATTTCAGTTTTGTTAGGCTGTTCTGGCATTTCGGTAACATTCAATGGAACAAAGAGTGTAGCAATACTAAATGATTTTCGAATAAAATGAATACTTCAAAATTTCATGTAATTTATGGTTTAGTTGAAAATGTGACAAATTCGGAATTTTAATGAAATATTTTCACCAAATTCCCAATGTTAAACTCATGTGGGCTGAGAGATTTTTGGATGAGGAGATGGATCTGTGTTGCATGTGTTAGTTTGAGGGTCTTCACCTCCGGGGACCATCAGCTAATCTTGATTCTTTATGGCGGTGCTGCATTTGGCTTGGCTGATAATGCTTGCTTTACAGGTCTGCATTGATTTGAAATCTGTTTTATTCTGACCCTCAGGGAATCTCCGCAGCCATCCTTTCTAAGTGCACAAGAGACGAAGGATTTATACCTGTCAATAAAAACCTTTGG[T/C]AAGTGCTTCCTGACCCTCTAAATCCAGCCACTGTTTTCGCCTTCCACCAAAAGAAGAGATGAGCCTCCAGAAGACACAAATCAGAGGCTGCTAAAACACGCGTTTAGGTACCTCTAACGACAGGCCGTCCTGTAAATAATCGGCCCCACTGGCACAGGAGTGAGACGCGGCGGGTGATGCATCCACTGTCCAACCAGATCACTCTTCTTTACAGCCAAGATGGAGTGAGCCGTTTTTATTTGGCCAACCGTATATATCTTGCCAACCGCGCTGGCTTATCTCATCCGCCTGTTGTGAAATCGAGCAGGATGAGGTCAGCCCTACATCTTCAGGCTGCTGCACATTAAATTATTTGTCATCTAACACCTAATAAATAATGGCATGTAACAGAAATGTTCAACACACACCCGCTCAGTCATGCTGGATGTCTTTTAGTGCAAACAAATGTTTTGCTTAAAGCTTATTACATTTTTTAAATAGTTTGCTAATGGGCTAAGAAA
Associated Phenotype:
Not determined