Busch Lab

ZMP

ENSDARG00000091207

Ensembl ID:
ENSDARG00000091207
Human Orthologue:
GHSR
Human Description:
growth hormone secretagogue receptor [Source:HGNC Symbol;Acc:4267]
Mouse Orthologue:
Ghsr
Mouse Description:
growth hormone secretagogue receptor Gene [Source:MGI Symbol;Acc:MGI:2441906]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa16287 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16287
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129886 Nonsense 45 335 1 2
Genomic Location (Zv9):
Chromosome 15 (position 3061659)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3036666
GRCz11 15 2985543
KASP Assay ID:
2260-8072.1 (used for ordering genotyping assays)
KASP Sequence:
ATCCTGATCATCCAGCGCTTTAAGGACATGAAGACCACCACCAACCTGTA[T/A]CTCTCCAGCATGGCCATCTCAGACCTGGTCATCTTCCTCAGCCTGCCCTT
Associated Phenotype:
Not determined