Busch Lab

ZMP

ENSDARG00000091093

Ensembl ID:
ENSDARG00000091093

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa35281 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38886 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35281
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130327 Essential Splice Site 30 220 1 3
Genomic Location (Zv9):
Chromosome 12 (position 23053120)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 21576483
GRCz11 12 21697702
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGATCTTACGGCCATACTGCAGCCCAAGTCATCACCTTGTTCCACCTG[G/A]TAAGCAAATGAAGCACTAATTAGCAACATGCACAGTTAAACAATTTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38886
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130327 Nonsense 186 220 3 3
Genomic Location (Zv9):
Chromosome 12 (position 23057906)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 21581269
GRCz11 12 21702488
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGTGGCTGGTTTGAGGGTAGTTTCTCTGTTCAACCAGGAAAAGGACAAT[G/A]GCTAGATGGAGTCATCTGTGACCTCCAGGTCATTTATGAGGACCCAATGC
Associated Phenotype:
Not determined