Busch Lab

ZMP

IL1RAP

Ensembl ID:
ENSDARG00000091088
Description:
interleukin 1 receptor accessory protein [Source:HGNC Symbol;Acc:5995]
Human Orthologue:
IL1RAP
Human Description:
interleukin 1 receptor accessory protein [Source:HGNC Symbol;Acc:5995]
Mouse Orthologue:
Il1rap
Mouse Description:
interleukin 1 receptor accessory protein Gene [Source:MGI Symbol;Acc:MGI:104975]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa22728 Nonsense Available for shipment Available now
sa22729 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22728
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081555 Nonsense 57 308 1 4
Genomic Location (Zv9):
Chromosome 15 (position 44184291)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45338614
GRCz11 15 45346666
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATGGATTTTTCAGCTGATGACCTGCAGAGGGAGTTTAACTGTTCTGCC[A/T]GAAACAGACACGGCTTCAACACCAGCAGAGCACGACTCAAAGCTGAACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22729
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081555 Nonsense 68 308 1 4
Genomic Location (Zv9):
Chromosome 15 (position 44184324)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45338581
GRCz11 15 45346633
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTTAACTGTTCTGCCAGAAACAGACACGGCTTCAACACCAGCAGAGCA[C/T]GACTCAAAGCTGAACGTAAATACACACACACACTCACTGTCTCTCTTTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28546
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081555 Nonsense 84 308 2 4
Genomic Location (Zv9):
Chromosome 15 (position 44186716)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45336189
GRCz11 15 45344241
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGTGTGTAGCATATGTGCCGACGCTGGAGCTGAGCTGTGGTT[T/A]AGGGGTGACGCTAGCACTCATGTTGATGATGTTCGTCATTTATCACGTCT
Associated Phenotype:
Not determined