Busch Lab

ZMP

si:ch211-207g17.1

Ensembl ID:
ENSDARG00000091006
ZFIN ID:
ZDB-GENE-100922-152
Human Orthologue:
COBL
Human Description:
cordon-bleu homolog (mouse) [Source:HGNC Symbol;Acc:22199]
Mouse Orthologue:
Cobl
Mouse Description:
cordon-bleu Gene [Source:MGI Symbol;Acc:MGI:105056]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36044 Nonsense Mutation detected in F1 DNA Not yet available
sa22756 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36044
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123710 Nonsense 68 708 1 4
ENSDART00000136939 None None 335 None 4
Genomic Location (Zv9):
Chromosome 16 (position 9840963)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8626902
GRCz11 16 8540631
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCAAAGCATCTCTAGCCAACCGTGCACACCGTGTGGAGTTATCCAAAAC[A/T]AAAACAACAATGCCTGTCTAACAGAGGAGAAACACAGAAGCCCATTCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22756
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123710 Nonsense 690 708 4 4
ENSDART00000136939 Nonsense 317 335 4 4
Genomic Location (Zv9):
Chromosome 16 (position 9832750)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8618689
GRCz11 16 8532418
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAACTTGATGCTTTTATTTACACAGGTCCCTGTCACACAGACAAGAAGG[C/T]AAGTGAACGGGAGACTTGGCACCATTCAAGCAACATCACCCCTCTCTTAC
Associated Phenotype:
Not determined