Busch Lab

ZMP

CC2D2A

Ensembl ID:
ENSDARG00000090971
Description:
coiled-coil and C2 domain containing 2A [Source:HGNC Symbol;Acc:29253]
Human Orthologue:
CC2D2A
Human Description:
coiled-coil and C2 domain containing 2A [Source:HGNC Symbol;Acc:29253]
Mouse Orthologue:
Cc2d2a
Mouse Description:
coiled-coil and C2 domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:1924487]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa29863 Essential Splice Site Mutation detected in F1 DNA Not yet available
e50 Nonsense Available for shipment Available now
sa16835 Nonsense Available for shipment Available now
sa10580 Essential Splice Site Available for shipment Available now
sa32422 Nonsense Available for shipment Available now
sa24244 Essential Splice Site Available for shipment Available now
sa13219 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29863
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126768 Essential Splice Site 30 1666 2 38
Genomic Location (Zv9):
Chromosome 23 (position 2209835)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2256898
GRCz11 23 2192576
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGGAGAGAACTGCAGGAGTCTTTAGGAAAAGTCAGGGATGATAAACAG[G/A]TAACAACAGAGTGCGGTATTTCAATGTTAAATATACTTACACTCACTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
e50
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126768 Nonsense 223 1666 9 38
Genomic Location (Zv9):
Chromosome 23 (position 2220817)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2267880
GRCz11 23 2203558
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTCTGCTGATCAGGTTGAGGCTGGTTTGCCGACCGCCGAAGAGGCCTA[C/A]AACTTCTTCACCTTCAACTTTGACCCGGAGCCTGAACAGCAGCGCCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16835
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126768 Nonsense 440 1666 13 38
Genomic Location (Zv9):
Chromosome 23 (position 2230216)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2277279
GRCz11 23 2212957
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGTTGTTCGCTCTGTCTCAGGCTCTGAAGTCGAAGCATGTGAACCTCTA[T/A]ATAGCTGGAATGGGGGATCMTCAGGCAGACTACCARCTGGATGTAGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10580
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126768 Essential Splice Site 501 1666 14 38
Genomic Location (Zv9):
Chromosome 23 (position 2230480)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2277543
GRCz11 23 2213221
KASP Assay ID:
2261-7255.1 (used for ordering genotyping assays)
KASP Sequence:
CCAGTCCTCAAGCTCTCGCTYTTGAAACTCAGTCTGAATGTGTGTGTGTA[G/A]TTGAACAGCTTGAGGAACACGATTCATARCATGCTGGAGCTGCACAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32422
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126768 Nonsense 628 1666 16 38
Genomic Location (Zv9):
Chromosome 23 (position 2233633)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2280696
GRCz11 23 2216374
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGAATATCAGAGGAAGATGAATGAATACAGGAGACTGCATGAGGAATG[G/A]AAATCCTGGAAAAGAAAACAGGTACGGCTATGCAGACGAAGCAGTGGGGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29864
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126768 Nonsense 743 1666 18 38
Genomic Location (Zv9):
Chromosome 23 (position 2237290)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2284353
GRCz11 23 2220031
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAACGATCACTCTTCGTTAAAGTCCTGTACAACGATAAAGAAGTTTCC[A/T]GAACCGACAGTCGAACCCTCAACATGGACTTCAGAGTTCACTTCGGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24244
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126768 Essential Splice Site 827 1666 19 38
Genomic Location (Zv9):
Chromosome 23 (position 2238198)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2285261
GRCz11 23 2220939
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAGCAGCAACCAGAGAGTCACATTCAATCACGAGGGGGTCGGCAGTGG[T/C]GAGAGCTCTTTTTAAATATATACAAATAAAATGTTTTTCAGTGCACAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13219
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126768 Nonsense 1368 1666 31 38
Genomic Location (Zv9):
Chromosome 23 (position 2263934)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2310997
GRCz11 23 2246675
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCCTCTRAAYCCACCACAGGAGCTGCTGGAYGCTTCYCCCAACGGCACA[C/T]AGGACAGCACGGTTCGCCCTCCACTGACAGACACTYTTMTGTCWCTCAGT
Associated Phenotype:
Not determined