Busch Lab

ZMP

wu:fq41a10

Ensembl ID:
ENSDARG00000090872
ZFIN ID:
ZDB-GENE-060720-44
Human Orthologue:
C7orf57
Human Description:
chromosome 7 open reading frame 57 [Source:HGNC Symbol;Acc:22247]
Mouse Orthologue:
Gm11992
Mouse Description:
predicted gene 11992 Gene [Source:MGI Symbol;Acc:MGI:3651127]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40650 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26698
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121822 Nonsense 16 220 2 7
Genomic Location (Zv9):
Chromosome 6 (position 12225611)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12078833
GRCz11 6 12313691
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATCTTTGCATAATAAAGCAGATATTCTAACTGAATTGTAGGTGTAAAA[C/T]AAGCTCAGAATGCTAGTTCAAACGGAGCAGTTGGACCCTCGTCCCAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40650
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121822 Nonsense 185 220 6 7
Genomic Location (Zv9):
Chromosome 6 (position 12214462)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12067684
GRCz11 6 12302542
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTTCCCATGATAAGAAGGAGGCAGCTCCGGTCAACATGTCCAAACTTT[T/A]AAGCTTTGGTTACGCTCAGGATGAAAATAAATCTCCCAATGATGATGATG
Associated Phenotype:
Not determined