Busch Lab

ZMP

ciita

Ensembl ID:
ENSDARG00000090851
ZFIN ID:
ZDB-GENE-071116-6
Human Orthologue:
CIITA
Human Description:
class II, major histocompatibility complex, transactivator [Source:HGNC Symbol;Acc:7067]
Mouse Orthologue:
Ciita
Mouse Description:
class II transactivator Gene [Source:MGI Symbol;Acc:MGI:108445]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa20014 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26064
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130281 Nonsense 780 1044 12 20
Genomic Location (Zv9):
Chromosome 3 (position 26103372)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26783600
GRCz11 3 26914471
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGCAAGCGCAATGAAGCGGACCTTCACCATTAACCTGCAGGACACATG[C/A]ATTCCCATCAGAGGCCTGAAAGAGCTTGTGGGTCTCAAATGTATCGCATC
Long Flanking Sequence:
TCTGAGCAAGAGGAAAACCACTTTGCTGACCTTTTCACTCAGAACTTCCTAAGTGCTTTGCATTTGGTGCAATCCAAACAGGTCAATGATAAAACGGTGGTGGCAAATACCATGGTGCAGCACAAAAAACGAAAGGTTCAGGGAGAATCGCAGGACGTCCTGCAGAGGTTCATCACCGGCTTAATCTTCCAGAAGACAGCAAGTGGACTCAGCATAATAGACAGCAGTGTGGACTTAAAAGCCAAAAGGAAGGCCGTCGAAGCTCATTTAGAGAGCATGAAACCCAAAGATTTGGTTCCTGCCAGATTACTTGAATTGTTTCACTGTGTTTACGAGACCTGCAGTGTCAAATTTGCCCAAGGGCTAGTAAAGAACCTGCCCGATGATCTGTCTTTCTGTGGGACCCAGCTTTCCCCATCGGATGTGTACGTGATATGCCATATCCTTCAACATGCAAGCGCAATGAAGCGGACCTTCACCATTAACCTGCAGGACACATG[C/A]ATTCCCATCAGAGGCCTGAAAGAGCTTGTGGGTCTCAAATGTATCGCATCCTTCTGGTGAGAAGTTACACGGCTGTACACCTAGATAGGAAAATGTTTTGTTTGCTGAGTTTAAAGCCTGTGAGACCTAACCTTTTTCTGTGAAATACTGAAAGATGCTGATTTTATTCCAGTTCAGATACAGTCTGTATCTGTAAGCTTCAAAAAAGAGTGCAAAAAATCTAAGGTAGACACTCTTAGTTCCCGCTTTATATGAAGTGGCCTCAAAGATACCGAGAAGTGCTTTGAAATGTGCATTTCTTATTCGATGTTTAATGTAATTTCAACTGAAACATGAAGAGAGGGTGAGACATAGAGTAGCTCCTTCTCTTTAAATAAGAAAACCAATAGCGTTTTGTTTCATAACAGCTCTGTCAGTGAGAGTGGTTGAATATTATAAAGTATTTGGTCAAGATTTGTTGAGGTGACGTGAAAAAAAAAAAAAACATATCCATTTAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20014
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130281 Nonsense 784 1044 12 20
Genomic Location (Zv9):
Chromosome 3 (position 26103382)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26783590
GRCz11 3 26914461
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATGAAGCGGACCTTCACCATTAACCTGCAGGACACATGCATTCCCATC[A/T]GAGGCCTGAAAGAGCTTGTGGGTCTCAAATGTATCGCATCCTTCTGGTGA
Long Flanking Sequence:
AGGAAAACCACTTTGCTGACCTTTTCACTCAGAACTTCCTAAGTGCTTTGCATTTGGTGCAATCCAAACAGGTCAATGATAAAACGGTGGTGGCAAATACCATGGTGCAGCACAAAAAACGAAAGGTTCAGGGAGAATCGCAGGACGTCCTGCAGAGGTTCATCACCGGCTTAATCTTCCAGAAGACAGCAAGTGGACTCAGCATAATAGACAGCAGTGTGGACTTAAAAGCCAAAAGGAAGGCCGTCGAAGCTCATTTAGAGAGCATGAAACCCAAAGATTTGGTTCCTGCCAGATTACTTGAATTGTTTCACTGTGTTTACGAGACCTGCAGTGTCAAATTTGCCCAAGGGCTAGTAAAGAACCTGCCCGATGATCTGTCTTTCTGTGGGACCCAGCTTTCCCCATCGGATGTGTACGTGATATGCCATATCCTTCAACATGCAAGCGCAATGAAGCGGACCTTCACCATTAACCTGCAGGACACATGCATTCCCATC[A/T]GAGGCCTGAAAGAGCTTGTGGGTCTCAAATGTATCGCATCCTTCTGGTGAGAAGTTACACGGCTGTACACCTAGATAGGAAAATGTTTTGTTTGCTGAGTTTAAAGCCTGTGAGACCTAACCTTTTTCTGTGAAATACTGAAAGATGCTGATTTTATTCCAGTTCAGATACAGTCTGTATCTGTAAGCTTCAAAAAAGAGTGCAAAAAATCTAAGGTAGACACTCTTAGTTCCCGCTTTATATGAAGTGGCCTCAAAGATACCGAGAAGTGCTTTGAAATGTGCATTTCTTATTCGATGTTTAATGTAATTTCAACTGAAACATGAAGAGAGGGTGAGACATAGAGTAGCTCCTTCTCTTTAAATAAGAAAACCAATAGCGTTTTGTTTCATAACAGCTCTGTCAGTGAGAGTGGTTGAATATTATAAAGTATTTGGTCAAGATTTGTTGAGGTGACGTGAAAAAAAAAAAAAACATATCCATTTAAGTGGAAGTTGCAA
Associated Phenotype:
Not determined