Busch Lab

ZMP

CNTROB

Ensembl ID:
ENSDARG00000090801
Description:
centrobin, centrosomal BRCA2 interacting protein [Source:HGNC Symbol;Acc:29616]
Human Orthologue:
CNTROB
Human Description:
centrobin, centrosomal BRCA2 interacting protein [Source:HGNC Symbol;Acc:29616]
Mouse Orthologue:
Cntrob
Mouse Description:
centrobin, centrosomal BRCA2 interacting protein Gene [Source:MGI Symbol;Acc:MGI:2443290]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa45814 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45814
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129102 Nonsense 49 165 1 3
Genomic Location (Zv9):
Chromosome 23 (position 44570142)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44637691
GRCz11 23 44443095
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAGCTCCACAAACTCCAGACAGAGTCGCATGACACACGGACGAATCTA[C/T]AACAACAAATCAAGGAGCTGCAGCAGCACACACAAGAATTACAGCAGCAG
Associated Phenotype:
Not determined