Busch Lab

ZMP

si:dkey-175c11.1

Ensembl ID:
ENSDARG00000090797
ZFIN ID:
ZDB-GENE-050309-42
Description:
hypothetical protein LOC793922 [Source:RefSeq peptide;Acc:NP_001119926]
Human Orthologue:
C12orf34
Human Description:
chromosome 12 open reading frame 34 [Source:HGNC Symbol;Acc:25915]
Mouse Orthologue:
BC057022
Mouse Description:
cDNA sequence BC057022 Gene [Source:MGI Symbol;Acc:MGI:3605543]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa10343 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10343
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128886 Nonsense 106 435 2 4
ENSDART00000131924 Nonsense 157 527 2 2
Genomic Location (Zv9):
Chromosome 5 (position 21535110)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19247982
GRCz11 5 19751782
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGGGCAGRAGGACTAAGTTGTCTCCTGCRMAAATAGCAGWGGCTCCTTA[T/A]CCACCTCCCAACAGCAGCACTTTAGGTCATTGCCATGGACAGATTGTGTA
Long Flanking Sequence:
TTTAGAAGACTCTCTAGACCTCTGATTTCTGATTAAAAAAAGGTTACCAGAAGCTGTCAAGCTCCTAGAATTTAACACAACTGTAAACTATACAAATCTCTAAAAACGTACCTTATAATTTTTTTGTGTGTGTGTCTTGCAGGTGAGCTGACTGTCCCCATGCCCTCCCCGCGCTACCCCAGCGCAGCAGAGCTGGATGCCTATGCGCAAAAAACAGCCAGCAGCCCCCTGTCCATCAAGATCTTCCCCACCAACATCAGGGTTCCCCAACACAAGCACCTTAACCGGACTGTGAATGGATACGACACCACGGGACAGCGCTACAGCCCCTACCCCCACCTCCACACAGGGGGCTACCAGGGTCTGTTAGCAATCGTCAAAGTCTCATCATCATCATCCTCATCCTGCTCATCTTTTGTACCCTCCGCAAAGGGCGTCCTCAAAAACTCAGAGGGCAGGAGGACTAAGTTGTCTCCTGCGCAAATAGCAGTGGCTCCTTA[T/A]CCACCTCCCAACAGCAGCACTTTAGGTCATTGCCATGGACAGATTGTGTACCACACAGGGCCACCCAAACCACCAGAGGCCACCACTTTATCGGTCCCACCTAACGTCACTGTGGCTGGCTCTGTGATCCCTGTGGCAGGAGGCCGAGGACTGAATCTCCCTCCTCAGTCCAATCTTCCCTCCATCCAGAGCATCATTTACCAGATCAACCAGCACTGCCAAGCCCAGGCTCTGCAGCAGGTGTGTCAGAACGGGACGTCTACGGGACCTCCAAACCCCAGCCCTTCCAAACAGGGCACCACTAACTCCTCAGGGGGGACCTACGTCACTGGTGTGGCTCCACAGGGAAACATGCCCTATTCAGGGACGGTGATACCAGGGCAGAACGGGGAGGTCCTGAAGGCCGGGGTGTATCCCGAAGGTATGGACTATCTGCTGTGGCAGAAACAACAGCATCATCATCAGCAGCAGCAGGCAGTTTTGAGGATGTACAGTGGAGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6966
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128886 Essential Splice Site 365 435 None 4
ENSDART00000131924 None 432 527 2 2
Genomic Location (Zv9):
Chromosome 5 (position 21535935)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19248807
GRCz11 5 19752607
KASP Assay ID:
554-4799.1 (used for ordering genotyping assays)
KASP Sequence:
GCTACAACCACAGCTGGACCGGTAACYGGACACAGGGAGCTGGGATTCCC[C/T]CATCATCACCAACACCCTCATCATCATCATCACCACCATCACCAACACCA
Long Flanking Sequence:
GTCACTGGTGTGGCTCCACAGGGAAACATGCCCTATTCAGGGACGGTGATACCAGGGCAGAACGGGGAGGTCCTGAAGGCCGGGGTGTATCCCGAAGGTATGGACTATCTGCTGTGGCAGAAACAACAGCATCATCATCAGCAGCAGCAGGCAGTTTTGAGGATGTACAGTGGAGGAAGTGGAGGCGGAGGTGCAATCAGCAAGTCGCCAGAAACCTGTGGCCCGGTAGGGTCCATTATGCTTGGAGGGGCGCAGGTGTCCTCTTCCAGGGGTTATCCGATGACGGCCAGTACGAGTGGTGGGGGCGGACTAGAAAAAGTCAGCTCCTCTCCTTTGAACTGTGTTGGGATGCATGGGAACTTTTCTGTCGGCCAGTACTTTGCTCCTCCATGGAACAGTGTTCTGGTGACGCCAGACAGCGACTGCTACAACCCACAAGAGCTGCCAGGAGCTACAACCACAGCTGGACCGGTAACCGGACACAGGGAGCTGGGATTCCC[C/T]CATCATCACCAACACCCTCATCATCATCATCACCACCATCACCAACACCATCATCACCACCACCCACCCATAGACAGCACAGGTGGTCTGTGCTGCAGTTTGCCCAGTAAGAGTCTATGTAATACGTCAGTGTTGAGCAGCAGTCTGCAGTCACTGGAATACCTGATCAATGACATTCATCCCCCCTGCATCAAGGAGCAGATGCTAGGGAAGGGATATGAGACCGTGTCTGTGCCGAGACTTTTGGACCACCAGCATGCGCACATCCGCCTCCCTGTTTACAGATAAGAGGAGACTTGGTATGACCAATACAAAAAGCGACTGGAAAATCTTTAATCACAAACTGCAGTTGTTGCCATTGCCTAGATTTGCAGTGGAGTTACGTGATCCTGCTCAAAGCAGACTGGGGGAGATCTGGATCAAAACAAGCTTGGGTGAATGCTGGAAAGCCAATCGGTGCCTCTCGGCTCAGAGCTGGGAGAGAATAGCTGGCTAGAAAT
Associated Phenotype:
Not determined