Busch Lab

ZMP

HECW1 (2 of 2)

Ensembl ID:
ENSDARG00000090795
Description:
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 [Source:HGNC Symbol;Acc:22195]
Human Orthologue:
HECW1
Human Description:
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 [Source:HGNC Symbol;Acc:22195]
Mouse Orthologue:
Hecw1
Mouse Description:
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 Gene [Source:MGI Symbol;Acc:MGI:2444

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa15027 Essential Splice Site Available for shipment Available now
sa30017 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15027
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090301 Essential Splice Site 353 494 9 12
Genomic Location (Zv9):
Chromosome 24 (position 216070)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 179953
GRCz11 24 731727
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCGGGGGGTCATGCAGCAAGCCGAAGCCCTTGTYAGGGGTTTCTATGAG[G/A]TACAAAAGCTGGAACAGTAGACGATCCACACACAGGAAGCAATTACAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30017
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090301 Nonsense 393 494 11 12
Genomic Location (Zv9):
Chromosome 24 (position 218902)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 182785
GRCz11 24 734559
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTATTAAAACAGGAGTATCAATGTCCATGTAAACATCTCCTGCAGGTTA[T/A]CATGATGGCCACATGGTGATGCGCTGGTTCTGGGCGGCAGTGGAGCGCTT
Associated Phenotype:
Not determined