Busch Lab

ZMP

ENSDARG00000090782

Ensembl ID:
ENSDARG00000090782

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa44426 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44426
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123135 Essential Splice Site 218 448 4 4
Genomic Location (Zv9):
Chromosome Zv9_NA851 (position 38087)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150703.1 38087
GRCz11 KN150703.1 38087
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTGCTCAGATACTGAGAAGACTTCCTCACAGAAAAGAACTAAAAAAAAC[A/T]GAGGTGAAAAATCTTTCCTCTGCCAACAGTGTGGAAAGAGTTTTAGGCAA
Long Flanking Sequence:
AGGGCTTTTGGACCATACTGAGTCTGACCTGTTATCTAGTACCTTTTTTGTCTTGCGACACTTTACCAGAGGCATTTAGCTCACTAAACATAGCTCCTAGGATCATTCAGGCCCTCAAACCTTCCACCATGATAAGGTAGTGGTTCATTATATGCTTAATTCTCATTAAAAATTATATGGAAACAGTAAATAATTGAGAATGGTTTACTTTTGTCTGATGTTAAGCTGTACATCTGACATTTTAGTTTACTTTATTTCATTAGTTGTAAGATGGTTTTGATGCTTCATACTTTATCTCAAGATTTTCACGTTTGTTGAAATGTTTTTTGTTTTGTTTTCTCGCAGTAGAGCTGATTGAACTGAAAGAGGAGACTGAAGTACTCATTGAAGAAGAAGAGCAAGATCAACATGAGAAGCATTTTGGTTTCAAAACTGAAGAAGCATCCTTTAGTTGCTCAGATACTGAGAAGACTTCCTCACAGAAAAGAACTAAAAAAAAC[A/T]GAGGTGAAAAATCTTTCCTCTGCCAACAGTGTGGAAAGAGTTTTAGGCAACATGAACATCTTAAGGTCCACACGAGGATTCACACTGGAGAGAAACCTTACTCCTGCCAAGAGTGTGGAAAGAGTTTCAGTCAATCTTCTTCACTTAAAATCCACATGAAGATTCACTCTGGAGAGAAGCCGTTTACCTGTGAGCAGTGTGGAAAGAGTTTCAGACAAAGTAAAAGCCTTGTTGGACACAGAAGAATTCACACTGGAGAAAAGCCTTACACCTGCACACTGTGTGGAAAGAGCTTCATTCATGCTGAAGGACTTGGAATCCACATGAGAATTCACACTGGAGAAAAGCCCTTCACCTGCCAAGAGTGTGGGAAGAGTTTCAGCAGAAAAGAAACCCTTAAATACCACATGACAGTCCACTCTGGAGAGAAGATTTTCACCTGCAAACAGTGTGGAATACGTTTCACTCAAAAGGTCAGCTTTAGGAAACACGTTTTAGTT
Associated Phenotype:
Not determined