Busch Lab

ZMP

ENSDARG00000090758

Ensembl ID:
ENSDARG00000090758

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa22827 Nonsense Available for shipment Available now
sa14398 Nonsense Available for shipment Available now
sa42712 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22827
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125201 Nonsense 22 515 1 1
Genomic Location (Zv9):
Chromosome 16 (position 25062189)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22966505
GRCz11 16 22881895
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACACCAGGCATTACGTATTGTCTCTTGGAACACTATGGGAATCAGGTA[C/A]ACAAAAGAAAAAAGCTCCAAGCTCCAGCTTGTGTTGGATGATCTCGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14398
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125201 Nonsense 136 515 1 1
Genomic Location (Zv9):
Chromosome 16 (position 25062531)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22966847
GRCz11 16 22882237
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGTACAATCACCAGGCAGACAGAGATATGCTGGGCAGAYTGAGAGACTA[T/A]TTGACAGCYATTAACACTAAAGGTGTGCTTGTGGTTGGTGGAGACTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42712
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125201 Nonsense 193 515 1 1
Genomic Location (Zv9):
Chromosome 16 (position 25062701)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22967017
GRCz11 16 22882407
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTCTTGAAGACTTCACACAATTTCTGAGTCTTGAAGATGTATTTGCAT[T/A]AAGGCACCCAATGGAAGAAGGCTTCACACGATCTCAGAGTCAGAGTCATT
Associated Phenotype:
Not determined