Busch Lab

ZMP

ENSDARG00000090740

Ensembl ID:
ENSDARG00000090740

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa13512 Nonsense Available for shipment Available now
sa30828 Nonsense Mutation detected in F1 DNA Not yet available
sa39985 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa13512
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128960 Nonsense 149 306 2 2
Genomic Location (Zv9):
Chromosome 3 (position 7415917)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6955061
GRCz11 3 6840901
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAAAGGAGAAGCCTTATTCATGCTCTGTGTGTGGAAAGAGTTTCTCATA[T/A]CAAGGAAACTTAGGAAAACATCAGACKATTCACACTGGTGTGAGAGAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30828
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128960 Nonsense 190 306 2 2
ENSDART00000128960 Nonsense 190 306 2 2
Genomic Location (Zv9):
Chromosome 3 (position 7415796)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6954940
GRCz11 3 6840780
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGCCTTTCGTACGGCTGAAGACTTGAAAGTACATGAGAGGATTCACACT[G/T]GAGAGAGACCTTACAAGTGTTCACACTGCGACAAGAGATTTAATCATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39985
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128960 Nonsense 190 306 2 2
ENSDART00000128960 Nonsense 190 306 2 2
Genomic Location (Zv9):
Chromosome 3 (position 7415796)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6954940
GRCz11 3 6840780
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGCCTTTCGTACGGCTGAAGACTTGAAAGTACATGAGAGGATTCACACT[G/T]GAGAGAGACCTTACAAGTGTTCACACTGCGACAAGAGATTTAATCATTCA
Associated Phenotype:
Not determined