Busch Lab

ZMP

zgc:158446

Ensembl ID:
ENSDARG00000090730
ZFIN ID:
ZDB-GENE-030131-2319
Description:
complement factor B [Source:RefSeq peptide;Acc:NP_001077327]
Human Orthologues:
CFB, XXbac-BPG116M5.17
Human Descriptions:
cDNA FLJ55673, highly similar to Complement factor B [Source:UniProtKB/TrEMBL;Acc:B4E1Z4]
complement factor B [Source:HGNC Symbol;Acc:1037]
Mouse Orthologue:
Cfb
Mouse Description:
complement factor B Gene [Source:MGI Symbol;Acc:MGI:105975]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa12079 Essential Splice Site Available for shipment Available now
sa9654 Essential Splice Site Available for shipment Available now
sa43662 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6676 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12079
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100784 Essential Splice Site 84 751 3 18
ENSDART00000125911 Essential Splice Site 73 440 2 10
Genomic Location (Zv9):
Chromosome 21 (position 26845229)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27414140
GRCz11 21 27450835
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATAAACACAACMATTTTKTMTGCTGCTCTCAAAWCAATTGCTTTTAYCWC[A/T]GAAATCACTTGTCCGGATCCTCGTGCATTTTTAAACGGAGATGTGCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9654
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100784 Essential Splice Site 204 751 4 18
ENSDART00000125911 Essential Splice Site 193 440 3 10
Genomic Location (Zv9):
Chromosome 21 (position 26845665)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27414576
GRCz11 21 27451271
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATGYCAGGAYAATGGACAGTGGTCAGGAACAGAGCCACAATGTTACGG[T/C]AAACACCCCTCTCTATGTCTTAAAGGCACAATACGNNNNNNTACGNNTTTTTTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43662
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100784 Essential Splice Site 235 751 5 18
ENSDART00000125911 Essential Splice Site 224 440 4 10
Genomic Location (Zv9):
Chromosome 21 (position 26846437)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27415348
GRCz11 21 27452043
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTTCTCTAGTGTCAAACCTACAGCTTACTCAACTGCATGAAGAAACAG[G/A]TAGTCTTGAGCAACTCTCGCAATCTTCCTCCTCTTTAAGATTTTTTTTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5682
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100784 Essential Splice Site 373 751 8 18
ENSDART00000125911 Essential Splice Site 362 440 7 10
Genomic Location (Zv9):
Chromosome 21 (position 26848265)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27417176
GRCz11 21 27453871
KASP Assay ID:
554-3620.1 (used for ordering genotyping assays)
KASP Sequence:
TAAGGAGGACTTCAAGGMGACCCAGCATATCGTCATCATGTTTACTGATG[G/A]TATCTATCAACTTACATACTTAGTACTGCGCCTTTTGAAGTGTGTTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6676
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100784 Nonsense 395 751 9 18
ENSDART00000125911 Nonsense 384 440 8 10
Genomic Location (Zv9):
Chromosome 21 (position 26849516)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27418427
GRCz11 21 27455122
KASP Assay ID:
554-4699.1 (used for ordering genotyping assays)
KASP Sequence:
TGGGTGGTAGTCCAAAACCATTGGTGGACAAGATCAAAAGTTTGGTCAGA[C/T]AAAATTCAGTGGAGGAAAAACTTGGTDAGGAAGAACACGAATGATTGAAA
Associated Phenotype:
Not determined