Busch Lab

ZMP

si:ch211-168n8.1

Ensembl ID:
ENSDARG00000090727
ZFIN ID:
ZDB-GENE-070912-150
Human Orthologue:
CELF5
Human Description:
CUGBP, Elav-like family member 5 [Source:HGNC Symbol;Acc:14058]
Mouse Orthologue:
Celf5
Mouse Description:
CUGBP, Elav-like family member 5 Gene [Source:MGI Symbol;Acc:MGI:2442333]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa18527 Nonsense Available for shipment Available now
sa33053 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18527
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122509 Nonsense 28 187 1 4
ENSDART00000147581 Nonsense 35 170 1 4
Genomic Location (Zv9):
Chromosome 2 (position 53912167)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 53632955
GRCz11 2 53359336
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTACYGTCTCTTCGAGCCCTACGGAGTCATCGAGGAGTGCACYGTATTA[C/T]GAGGCCCTGATGGAAACAGTAAAGGTGAGATTCAGTTCCTGCTTTTATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33053
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122509 Nonsense 35 187 1 4
ENSDART00000147581 Nonsense 42 170 1 4
Genomic Location (Zv9):
Chromosome 2 (position 53912146)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 53632976
GRCz11 2 53359357
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGGAGTCATCGAGGAGTGCACCGTATTACGAGGCCCTGATGGAAACAGT[A/T]AAGGTGAGATTCAGTTCCTGCTTTTATCTCTCTCGTCTGTGTTCAAGGCA
Associated Phenotype:
Not determined