Busch Lab

ZMP

eif3ea

Ensembl ID:
ENSDARG00000090697
ZFIN ID:
ZDB-GENE-030131-3827
Description:
Eukaryotic translation initiation factor 3 subunit E-A [Source:UniProtKB/Swiss-Prot;Acc:Q6DRI1]
Human Orthologue:
EIF3E
Human Description:
eukaryotic translation initiation factor 3, subunit E [Source:HGNC Symbol;Acc:3277]
Mouse Orthologue:
Eif3e
Mouse Description:
eukaryotic translation initiation factor 3, subunit E Gene [Source:MGI Symbol;Acc:MGI:99257]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa45584 Nonsense Mutation detected in F1 DNA Not yet available
sa22915 Essential Splice Site Available for shipment Available now
sa4677 Nonsense F2 line generated Not yet available
sa32103 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa45584
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126705 Nonsense 84 446 3 13
ENSDART00000140684 Nonsense 84 109 3 7
ENSDART00000144651 None None 157 None 5

The following transcripts of ENSDARG00000090697 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 41291577)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38676377
GRCz11 16 38626409
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTTGCAGCTCTTCGAGAGAAGAGAACTACAGTAGTGGCTCAACTCAAA[C/T]AACTCCAATCTGAAACGGAGCCAATTGTGAAGGTGTTTGAGGACCCAGAG
Long Flanking Sequence:
AATTTTCATTTTTAGGTCCCGCAATGCGTTTAATTTTCTCTCACACTGACACACACACACACACACACACACACACACACACACACACACACACACACACACACACATATGAGTAGACAAACAGGTGTTGATCAATTTTTCCTGCCAGTCAAAACCTACAAGTAGAAAAAGTCAAATATTTTTGATAAACTTATTAAAGTATTCTCATATTCTTCGTGAATGTGCTTATCTTGTTTCTATTATCATTTTCTAGATCTACAATGAGCACGAGCTCCTCCATGGAAAGCTGGATCTCCTCAGTGACACCAACATGGTGGACTTTGCCATGGATGTATACAGGAATTTATTTCCTGACAAAGAAATACCCAACTGTAAGTGTTTTTACTTTTAATTGAAGCTTAATGTGATATGACTATGAGATTGTTAGTATTATTACTTATTTATATGTCTTCTTTGCAGCTCTTCGAGAGAAGAGAACTACAGTAGTGGCTCAACTCAAA[C/T]AACTCCAATCTGAAACGGAGCCAATTGTGAAGGTGTTTGAGGACCCAGAGACCACGAGGCAAATGCAGTCCACGAGGTAAATATTGAAATGACACGTACACAAACAGCTGATTTACATGAGTAAATTGCTATAGCCTGAAAGCAAAAATATTTTTATCAAAATTAGAGGAAATTGTTGTATTGTTTTTGTCATATTATTATTACTTCTTGTTATTAACATAAATCATTCATACATTTTCTTTTCGGCTTAGTCCCTTTATTAATCCAGGGTCGCCACAGCGGAATGAACCGCCAACTTATTTAGCACGTTTTTACGCAGAGGATACCCTTCCAGCCGCAACCCATCTCTGGAAAACATCCACACACACTCATTCACACTCGTACACTCCGGACAATTTAGCTTACCCAATTCACCTGTACAACATGTTTTTAGACTGTGGGGGAAACCTGAGCACCCGGAGGATACCCAGGCGAATGCAGGGAGAACATGCAAACTCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22915
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126705 Essential Splice Site 200 446 6 13
ENSDART00000140684 Essential Splice Site None 109 5 7
ENSDART00000144651 Essential Splice Site 58 157 2 5

The following transcripts of ENSDARG00000090697 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 41258448)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38643248
GRCz11 16 38593280
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCTGCCATGGAAGACCTGACCCGCCTGAGGGAGACTATCGATAACAAT[G/T]TAATGCCCCGCCACTCAGAATTCAATACCACATTCGGATTCCCTTACATA
Long Flanking Sequence:
TATTTTCTAAAATTTCATGGTTCTTTGCAGAACAAAAGTTATATATATATATATGAATTCAACTATTCTTTCAAGATTTATTTCTTTTTCCCCTGCAAGACCAATTCCCGAAGATGACATAATTTAATCCATTTATCCACTTTAAATAAATAAAGAAGTTACTCTGGCGATCAGCGTTGCCAAGAAAGCTCAAATTTTAGCTGTGGGAAATGGCAGATGTCAGAAATACAATATTTCTAAAGTGGAAAAGCACCAAGAGTGCCATCCAGCCAGTATAATTTGCTGCTGTTTTTATGGGAAGTGAGTTGATTTCATTGTCTTTGTTTGTTTACAGTGGGTCAATGTATTTCTCTTGTGTTTGTGTGTTTGTGCAGGTCCCGGCCACAGACAGAAACGCGCTGAACTCTCTGTGGGGCAAACTGGCTTCAGAGATCCTGATGCAGAACTGGGAAGCTGCCATGGAAGACCTGACCCGCCTGAGGGAGACTATCGATAACAAT[G/T]TAATGCCCCGCCACTCAGAATTCAATACCACATTCGGATTCCCTTACATAGGCCATAATATTGACCGCTTTGCGTTTGAGCACAGCACCACTCGCTGCTGTTGCCGTTCCTTCTCTCTTCCATCTCCTGATTCCTTCTCACCGCAGCTCACAAGTCAAGCAAAACCTTAATTGCTGTGTTCTGTCGGCACAGCTTGATTTTTAATTGGAGGAATTGAGCTGGGAAAGGAGGGTTTGGTTTGGGGCGAAGTATGAGTAAATAAAAAATTAAAGTCTTAGGACATTGTAAAATTCTATTCTGAACTTTGATTTGAACTGAGTCTGGAAGGCAACCGAAGCCAAATGTTTGTTTTTCGGAGTCAGAAGTTCATCTTGCTGTAGTCACGATCAAAACAAATCACCTTTTAAAGGGGAGTTCACTCCAAAAGCAATATTTTATGATTATTTACCTACTCTCGTGTTATTTCTTGTGTATTTTTCTTACTTGTACCCTTTTTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4677
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126705 Nonsense 251 446 8 13
ENSDART00000140684 None None 109 7 7
ENSDART00000144651 Nonsense 98 157 4 5

The following transcripts of ENSDARG00000090697 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 41248050)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38632850
GRCz11 16 38582882
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTGTTGTTTGTTTTGTTTACAGGTACCTCAATGCTATTCAGACCATGTG[T/A]CCACACATACTGCGCTATCTGACCACAGCCGTCATCACCAACAAGGACGT
Long Flanking Sequence:
CAATCCCTGTATTTATATGAAATTCATGATTTATGCAAAATAATGTCTTGGTTAGAAGTTTTGTCTTGTTTCTAGTTCAAATATCCACATTTCAAGGTCAAAATAAGATTATTTTACTTACCCCTCTGGCAGATAATTTTGCTTGTTTTAAGGATTAACTCTTGATTTTTGACTTTTTACTTGAATTTTGACTTATTTCTGCTGACGGTTAAAACAAAACAGTATTTCACTTGCTCTAAGAATCTACCAAGAAATTTTAGGATGTCTGCAACTACTGATGGCTAAGTTTTTATATAATCTTAAGCATACGCGTCTTCATTCAGGATATTTGCATTAAAGTATTGAATTTTTTTTTTTTTTTTGTTGGAGCCTGCTTTGTAACTGTTTACATTAATCTTTGTACAATAAATGTTTATTACCTGTTTATTACCAGACACTTGACTTGTGGTTGTTGTTGTTTGTTTTGTTTACAGGTACCTCAATGCTATTCAGACCATGTG[T/A]CCACACATACTGCGCTATCTGACCACAGCCGTCATCACCAACAAGGACGTCCGCAAGCGTAGGCAGGTGCTGAAGGATCTGGTGAAAGTCATCCAGCAGGTATCAGACACCACTAGGCTTCCTTATTTGTGCATTTCTATCTCCTTCAGTCACTTTCTATTCATTATTGAATATACTATATTATCTAATATAATATACTATATTTAATATCTAATATAATATACTATATTTATTATACAGCATATTTTAATTGTTTTAAATTTGATAATTGTTTTTTTATATAACATTTAATAAAATGTAGTGATGCAATAAAGTAGTGATGCACAATAAATTGATATAATGTATATGAATAAAAATTTACTTATGTATTTTAATTTAAAAAGATAAATATTTTTACTTATGTGATGTACCATAAAATACATCTTTTATAAACTTTTCAAATAAAAAGTATAGCGATGAACCGTTAAAAAAACAACAAATTCATCCACATCAAACAGCAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28712
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126705 Nonsense 315 446 9 13
ENSDART00000140684 None None 109 None 7
ENSDART00000144651 None None 157 None 5

The following transcripts of ENSDARG00000090697 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 41243606)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38628406
GRCz11 16 38578438
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGTCTGTATGTGAACTTCGACTTTGACAGCGCTCAGAAGAAGCTGCGA[G/T]AGTGCGAGGCGGTAAGATCCAGCTGTCTTTTCCCTGTTACCTTTTTATAA
Long Flanking Sequence:
GTTCTTGATTAAAATGTTAAAAACTGAAATGTATAGAGTGCCATAAAAGTAGTCCATATAACTTTTCAAAGCCTTCTTTAGGACTGTTTCAATGTATATAAAAATAAATTCATTAAATCCTCTATATATTTGTTTTTATATAATATAGGCAATTTAACTGTCAGCTTGTGTTAATTAGGGAAATAGATGCCACGGTTTGACAACAGCCCTGTTTGTAACCACAAGATGAAAGTAGTAACTTTGTGCTTGAACAGCCTATATCAGTTCTGCTTGTAACGTCACATTTTATTTCCTAATAAAGCATTCAAGTAAATTCATAATGAGAAACCCGCTCCAATTTGACTGCTAATCTTGAAGCACATTTAATTCCTACGTTTTTAAATGTTTCTCTGTTTTTTCCTTATTTTTAGGAGTCCTACACCTACAAAGACCCCATCACAGAGTTTGTGGAGTGTCTGTATGTGAACTTCGACTTTGACAGCGCTCAGAAGAAGCTGCGA[G/T]AGTGCGAGGCGGTAAGATCCAGCTGTCTTTTCCCTGTTACCTTTTTATAAGCTTGTTTCTTGGCGTGCCCTTTAAAGCACGGCACACCCTCCACTTTATAGGGACTTTTGCAGATTGATCGTATCTTCCTCTTCAGTCATGTTCCTGTTTTTTCCAAAAGCGTAAGATTCATAACATAACAGGTTCCATTAGCCAAAGCGTTTGAAGAGGCTATCCTTCTCCCAAGACATTGAGCTCATCCTTCACTTCTTGTCCAGCCACAAAAAGCTTTAACGTGGTAATTTACGCAGATGATGCCTTGATTTTCCCTGATGATGAGTTGTGAAGTCATCATACTGAGTCTCTGACCTCTGGTCGATCAGAAGTGTCCTCTGACAGATCCTCTAGTCTAGTGTTTTGCAATTTCAACATCACTAAACGTAATGCAAAATCAAGCAACATTTTGTGGAGTTTTTTTAATTATATTTTTTATATGCATCTCATATTTTGGGCAGTCTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32103
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126705 Essential Splice Site 389 446 11 13
ENSDART00000140684 None None 109 None 7
ENSDART00000144651 None None 157 None 5

The following transcripts of ENSDARG00000090697 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 41226435)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38611235
GRCz11 16 38561267
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACCTCATTCGTAATGCCAGGCTGGATGCCAAAATCGACTCCAAACTGG[T/C]GAGAGTCTCTCATATTTTATTTCGCTCTTGTTTCCCTGCCTCCCTCCTCA
Long Flanking Sequence:
TTTAAAATGCTTTTAAAAAACAGTAAAACTCATGCAGTGAGTGTTTTATTCCTGTCCTAAAGTTTGTTTCATCACTACCTTGACCTCAAACTCACGACGGCACGGTGATGTAATTCTACCCCGTTTTTATGGGTTTCTTAGTGCGATTAGAATCACAGACTTGATTACATAATGCAAGGCATTTGTCACTCTTGAACAGACGTCTAAATGCTGAGGTATGACAGTAAACCCATTATCATCCAGCACTTTCGATCAGCACTTTAAACCTGCACACACACACACACACAGCCACCGCAAGCTTGTTATATACCTCACAATTTTAACGTAATGCCATCAGAGTATATAATGTTCTCCTTTTACCTAAGTTTGTCCTAATGGACTGTGTTTGCCTCGCAGTATGCTGGCCGATAAGCTGAATATGACTCCTGAGGAGGCAGAAAGATGGATCGTCAACCTCATTCGTAATGCCAGGCTGGATGCCAAAATCGACTCCAAACTGG[T/C]GAGAGTCTCTCATATTTTATTTCGCTCTTGTTTCCCTGCCTCCCTCCTCAAGTAGCGGCCAATTGATAGATGCTGCGTTAGTGTCCTTTAATTAGTAGGAAAATCAAATTCAGGCTCTTTTGTGCAGGGATAATGTTCTGCTTTAATACATAAAGGAGAGGCAATCAATTACGTCAGTAATTCTGCCCAGTGCCTGCTTTCTCACCATATCCTTTCTCGAGGGTTAGAGGAATACTGTCATTATAGTTCTGAAGGAGGGTCATTCGTAATGTGGAGACGTACTTTTTGGTCAAAATTAAGTTTATTATAAAGAAATCCTATGTGTGGAACATTCTGTTTTCATTAATATGTCAATTGTTTGCCCACCTTAGGCATTGCAATAGTTCATGAAGTGTATAAAAACTCAATTAAAGGTCCCATGAAAATAAAATAAATGTTTTAGATGTTTGTTTTTATAGATCTATACACAGTAGATATGACATACGAACCCTGAGTATACG
Associated Phenotype:
Not determined