Busch Lab

ZMP

si:busm1-118j2.5

Ensembl ID:
ENSDARG00000090689
ZFIN IDs:
ZDB-GENE-030131-7722, ZDB-GENE-090501-3
Description:
hypothetical protein LOC793447 [Source:RefSeq peptide;Acc:NP_001096600]
Human Orthologues:
HBB, HBD, HBE1, HBG1, HBG2
Human Descriptions:
hemoglobin, beta [Source:HGNC Symbol;Acc:4827]
hemoglobin, delta [Source:HGNC Symbol;Acc:4829]
hemoglobin, epsilon 1 [Source:HGNC Symbol;Acc:4830]
hemoglobin, gamma A [Source:HGNC Symbol;Acc:4831]
hemoglobin, gamma G [Source:HGNC Symbol;Acc:4832]
Mouse Orthologues:
Gm5736, Hbb-b1, Hbb-b2, Hbb-bh1, Hbb-y
Mouse Descriptions:
hemoglobin Y, beta-like embryonic chain Gene [Source:MGI Symbol;Acc:MGI:96027]
hemoglobin Z, beta-like embryonic chain Gene [Source:MGI Symbol;Acc:MGI:96024]
hemoglobin beta, bh2 Gene [Source:MGI Symbol;Acc:MGI:96025]
hemoglobin, beta adult major chain Gene [Source:MGI Symbol;Acc:MGI:96021]
hemoglobin, beta adult minor chain Gene [Source:MGI Symbol;Acc:MGI:96022]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa26160 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa26160
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128380 Essential Splice Site 31 147 None 3

The following transcripts of ENSDARG00000090689 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 55974484)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54859645
GRCz10 3 54868210
GRCz11 3 55114247
GRCz11 3 55122812
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTCGCCAAGGCTGACTACGACGTCATCGGTCCTCAGGCTCTGGCAAGG[T/G]AATGAGTCTTGGAGCTTATATTAACTTATATTTATAACATTACATAAGGC
Associated Phenotype:
Not determined