Busch Lab

ZMP

C17orf104

Ensembl ID:
ENSDARG00000090664
Description:
chromosome 17 open reading frame 104 [Source:HGNC Symbol;Acc:26670]
Human Orthologue:
C17orf104
Human Description:
chromosome 17 open reading frame 104 [Source:HGNC Symbol;Acc:26670]
Mouse Orthologue:
Gm1564
Mouse Description:
predicted gene 1564 Gene [Source:MGI Symbol;Acc:MGI:2686410]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa15914 Nonsense Available for shipment Available now
sa9789 Nonsense Available for shipment Available now
sa33207 Nonsense Mutation detected in F1 DNA Not yet available
sa25251 Nonsense Mutation detected in F1 DNA Not yet available
sa17841 Nonsense Available for shipment Available now
sa13122 Nonsense Available for shipment Available now
sa38397 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15914
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124559 Nonsense 110 851 4 8
Genomic Location (Zv9):
Chromosome 3 (position 31754669)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31485979
GRCz11 3 31617693
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAWAATTGTGGCAGTGAGGCTGATCTTTATGGATTAGTGTCAGATATCT[T/A]GGATGAACCAGATTCAGTGGACCCCTACCCCTCMTATGAGAAGTAAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9789
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124559 Nonsense 249 851 5 8
Genomic Location (Zv9):
Chromosome 3 (position 31752082)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31483392
GRCz11 3 31615106
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTGACAAAGAAGAAGGATACTTTAACCCCAMTAACTCCACATCTGATTA[T/G]ATAAACACGGCCAACTCCTATTATTCTTCTCAAAATTCAGATGACTCCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33207
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124559 Nonsense 299 851 5 8
Genomic Location (Zv9):
Chromosome 3 (position 31751933)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31483243
GRCz11 3 31614957
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACATCCAATCTTTCTCTGTCCAGGATGTCAGTAAGCTGGCCTTTCTGT[T/A]GGCAGAGCAGGACATGAACTACTGCAAAGAACCAACCCAGAATGGGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25251
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124559 Nonsense 321 851 5 8
Genomic Location (Zv9):
Chromosome 3 (position 31751866)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31483176
GRCz11 3 31614890
KASP Assay ID:
554-7495.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTACTGCAAAGAACCAACCCAGAATGGGTTTTTAACGCAGAGGAACTA[T/G]GAAGAAATCATGGCAGAGCAGAAAAGTCATCCTTTTCAAAGGATGTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17841
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124559 Nonsense 322 851 5 8
Genomic Location (Zv9):
Chromosome 3 (position 31751865)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31483175
GRCz11 3 31614889
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTACTGCAAAGAACCAACCCAGAATGGGTTTTTAACGCAGAGGAACTAT[G/T]AAGAAATCATGKCAGAGCAGAAAAGTCATCCTTTTCAAAGGATGTCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13122
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124559 Nonsense 421 851 5 8
Genomic Location (Zv9):
Chromosome 3 (position 31751568)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31482878
GRCz11 3 31614592
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
YAATGGRAAGTGGCATAACTCAAACCAGTGTTAATCTCTTTCACCCACTC[C/T]AGCCAAACCATTGTCAAATCCAAGCAAAKATTCCAGCAAAAACCAGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38397
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124559 Essential Splice Site 785 851 7 8
Genomic Location (Zv9):
Chromosome 3 (position 31746975)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31478285
GRCz11 3 31609999
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTAGCAACAGACAGAGGCAGCCGGCGGCCTTCTTTAGAGAGGACAGGGG[T/C]TAGTGAGTCACGCTTTAACATCAGCTCAGGCAGCAAGTACACATCTATAA
Associated Phenotype:
Not determined