Busch Lab

ZMP

LOC100334126

Ensembl ID:
ENSDARG00000090659
Human Orthologue:
SGCZ
Human Description:
sarcoglycan, zeta [Source:HGNC Symbol;Acc:14075]
Mouse Orthologue:
Sgcz
Mouse Description:
sarcoglycan zeta Gene [Source:MGI Symbol;Acc:MGI:2388820]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa18691 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa25550 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38252 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18691
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130418 Essential Splice Site 72 295 2 9
Genomic Location (Zv9):
Chromosome 1 (position 14523698)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15110484
GRCz11 1 15796997
KASP Assay ID:
2259-0350.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATTTAGCGTTGACCATCTGGATTCTAAAAGTCATGAACTTCACTGTGG[T/G]AAGCACTTCTCTGTCTCCTGTTGTTTTCCTCTGTTTATTGTCTATATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25550
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130418 Essential Splice Site 201 295 6 9
Genomic Location (Zv9):
Chromosome 1 (position 14408778)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 14995564
GRCz11 1 15682077
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTCAGTGGAAACGCCACACGTTCGAGCTGAACCATTCCAAGACCTGAA[G/A]TAAGGCATGCTTTCTTAATGTATCACATTATCATTCAGTGTGTGATTCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25549
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130418 Essential Splice Site 243 295 8 9
Genomic Location (Zv9):
Chromosome 1 (position 14350861)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 14937647
GRCz11 1 15624160
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTGTTTGCGCTCGCTTCCTCACCTCTCCTTGCTTCTCCTCCATTTTCC[A/T]GATTTATCTAAATGCAAACTCAATCCGTCTTGGAAATCTTCCACATGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38252
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130418 Nonsense 277 295 8 9
Genomic Location (Zv9):
Chromosome 1 (position 14350757)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 14937543
GRCz11 1 15624056
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGACCCTTTGCTCGGCCCAGGGACAACGTACCCCAAACAGACTGTGTAC[G/T]AGGTGTGTGTATGTCCCAGTGGCAAGCTGTATCTATCTCCTGCAGAGAGC
Associated Phenotype:
Not determined