Busch Lab

ZMP

ENSDARG00000090621

Ensembl ID:
ENSDARG00000090621
Human Orthologues:
AC012555.1, AC084199.1
Human Description:
Tetratricopeptide repeat protein GNN [Source:UniProtKB/Swiss-Prot;Acc:Q6P2S7]
Mouse Orthologue:
BC030307
Mouse Description:
cDNA sequence BC030307 Gene [Source:MGI Symbol;Acc:MGI:2387653]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40226 Nonsense Mutation detected in F1 DNA Not yet available
sa26227 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40226
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017777 Nonsense 51 259 1 3
Genomic Location (Zv9):
Chromosome 4 (position 8897870)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9834718
GRCz11 4 9835634
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACCGCTCATCATTTTTCATTTGTCTGCTTGGACACAGCTATGGACAGTG[T/A]CTTCCTGATATCGAATCATGTTCTTCATCTGAAGTTGTTAGAAAGCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26227
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017777 Nonsense 163 259 1 3
Genomic Location (Zv9):
Chromosome 4 (position 8897534)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9834382
GRCz11 4 9835298
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTGAGAGACAGAGACTGAGAGATCTGAAAAGAAGAATCATAAATCACTG[T/A]CTTCCTGTCAGGTTTGAGGATATAGGCAAAAATGTCTTACAAATTAACTT
Associated Phenotype:
Not determined