Busch Lab

ZMP

LOC100334642

Ensembl ID:
ENSDARG00000090611
Human Orthologue:
CASKIN1
Human Description:
CASK interacting protein 1 [Source:HGNC Symbol;Acc:20879]
Mouse Orthologue:
Caskin1
Mouse Description:
CASK interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:2442952]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa38219 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44427 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38219
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130451 Essential Splice Site 139 352 4 9
Genomic Location (Zv9):
Chromosome Zv9_NA86 (position 56229)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150646.1 56229
GRCz11 KN150646.1 56229
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGCTAAGAAGACTCCTCTGGATCTGGCCTGTGAGTTCGGCCGAGCGAAG[G/A]TCAGTAGTTTCAGCTGTGATGCGTCCTAATATCAGTGTTTATCTTCAATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30488
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130451 Essential Splice Site 139 352 4 9
Genomic Location (Zv9):
Chromosome Zv9_NA86 (position 56230)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150646.1 56230
GRCz11 KN150646.1 56230
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTAAGAAGACTCCTCTGGATCTGGCCTGTGAGTTCGGCCGAGCGAAGG[T/C]CAGTAGTTTCAGCTGTGATGCGTCCTAATATCAGTGTTTATCTTCAATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44427
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130451 Essential Splice Site 287 352 8 9
Genomic Location (Zv9):
Chromosome Zv9_NA86 (position 72436)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 31737531
GRCz10 KN150646.1 72436
GRCz11 24 31622139
GRCz11 KN150646.1 72436
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTTCACGACCCCACAGCCCTCACCATACGGGCCGGAGACGTCATCACG[G/T]TACAGACGCTTGCACTACACAATCTTAATATAGGGTCGGTGTGTGTTTGT
Associated Phenotype:
Not determined