Busch Lab

ZMP

kcnab1

Ensembl ID:
ENSDARG00000090580
ZFIN ID:
ZDB-GENE-050327-79
Description:
Novel protein similar to vertebrate potassium voltage-gated channel, shaker-related subfamily, beta
Human Orthologue:
KCNAB1
Human Description:
potassium voltage-gated channel, shaker-related subfamily, beta member 1 [Source:HGNC Symbol;Acc:622
Mouse Orthologue:
Kcnab1
Mouse Description:
potassium voltage-gated channel, shaker-related subfamily, beta member 1 Gene [Source:MGI Symbol;Acc

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6527
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028269 Nonsense 117 295 6 11
ENSDART00000145935 Nonsense 122 302 6 11
Genomic Location (Zv9):
Chromosome 18 (position 32873928)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 34551023
GRCz11 18 34527047
KASP Assay ID:
554-4580.1 (used for ordering genotyping assays)
KASP Sequence:
CCATGACCTACGTGATAAACCAAGGCATGTCCATGTACTGGGGGACTTCA[C/T]GATGGACAGCAATGGAAATAATGGTAAATAACATTTTTCTAAACATCACT
Associated Phenotype:
Not determined