Busch Lab

ZMP

ASCC3 (2 of 2)

Ensembl ID:
ENSDARG00000090561
Description:
activating signal cointegrator 1 complex subunit 3 [Source:HGNC Symbol;Acc:18697]
Human Orthologue:
ASCC3
Human Description:
activating signal cointegrator 1 complex subunit 3 [Source:HGNC Symbol;Acc:18697]
Mouse Orthologue:
Ascc3
Mouse Description:
activating signal cointegrator 1 complex subunit 3 Gene [Source:MGI Symbol;Acc:MGI:1925237]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36013 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36013
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Founder:
SL6_08_D6
KASP Assay Location:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121477 Nonsense 221 605 5 12
Genomic Location (Zv9):
Chromosome 16 (position 2436686)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1594842
GRCz11 16 1618730
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGCACGTCTCCATTTTTCCTCTAGGTGGAGTCGACCCAGAGTATGATC[C/T]GAATACTCGGTCTCTCTGCAACGTTGCCAAATTACCTGGACGTGGCGACT
Long Flanking Sequence:
ATCCCATTAAAACTTTTAACTTTGAATTTAAAAAGTAGTATTTAATTACTCTCTTATACTGTAACATTTGTCTAAAAGTTATCCATTTGTGTACTGCTGACCTGTCCTATATATATTTTCAATTATTGTATTGATAAATGTATTAAATTGTAATAATTTCTTGAAAGATCAAGCAAAAAGATGTTCTAACTGGGATATTCCAAAACAATCCGTAGCATTTAGCCCTGTAAAATAAAATTTAATTCATAAAAGTCTTCAAAATGTCTTTAAAAGTCTCAAATTTAACTTGAAACGTCTCAAGTAAACTTAAAAGTCTCAAATTTAACGTGAAGCCTGTAGAAACGCTGGTGCACAGAGACATAGCCCTCTTGCTAAATGTCCAATAGATTCCTGATCCACCCAACAAATCATTGGTGACCAAGCTAGATCTAGTATGATTGAGTGCACTTTAAAGCACGTCTCCATTTTTCCTCTAGGTGGAGTCGACCCAGAGTATGATC[C/T]GAATACTCGGTCTCTCTGCAACGTTGCCAAATTACCTGGACGTGGCGACTTTCCTCCATGTGAACCCTTTCATTGGATTGTTCTACTTCGACAGCCGTTTCCGTCCTGTTCCACTTGGCCAGAGCTTCGTTGGCATCAAGACTACAAATAAGGTATGCAGCAGCCAAGAAAACTCCAAATATAGTGATTACTGAGTCATATTTGAACGATCAGACAATAAAACAATGACATGTCTACATAATTATCCTCTGGTCACAGGTCCAACAGCTGCACGACATGGAGGAGGTTTGTTATGAAAAAGTCCTGAAGCAGATTAAAGCGGGTCACCAGGTAATGGCAGGATCGGTTTCTACTCTTTGTCGTTTAGCAGACGTTTCATAGATATTTTGGTTGGAGTGTGGGGATGTGTATGGTGTCAAGGGCATGGAGAAGGTTGGGTTATGATCCCACTCAGTCCAGATCCTGTCATCATGATTTAGATCTGAATGTGTAACCTCTAG
Associated Phenotype:
Not determined