Busch Lab

ZMP

si:dkey-102m7.1

Ensembl ID:
ENSDARG00000090527
ZFIN ID:
ZDB-GENE-091118-76
Human Orthologue:
FHDC1
Human Description:
FH2 domain containing 1 [Source:HGNC Symbol;Acc:29363]
Mouse Orthologue:
Fhdc1
Mouse Description:
FH2 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2684972]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa7389 Missense Mutation detected in F1 DNA Not yet available
sa42377 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa7389
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121612 Missense 209 916 5 11
ENSDART00000141628 Missense 209 916 6 12

The following transcripts of ENSDARG00000090527 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 18718943)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14513396
GRCz11 14 14818959
KASP Assay ID:
554-4321.1 (used for ordering genotyping assays)
KASP Sequence:
TCTCATCATCATCATGTGCAGCTTTCGCATGCGCCTGGACGTCATGATTC[T/A]CCAGCAGGAGTTTGACCCAGCTGTAACCTCTCTCTGTGTGGCGGCCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42377
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121612 Nonsense 758 916 11 11
ENSDART00000141628 Nonsense 758 916 12 12

The following transcripts of ENSDARG00000090527 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 18727189)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14521642
GRCz11 14 14827205
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTGGTAAAATCACCCACTCGAGGACCCACCAAAAGACTTCTGGTGCCC[C/T]GAGGAGGACCTTCCAACAGCAGTGGAATTCCAAGAGTACGCACAAAGTCA
Associated Phenotype:
Not determined