Busch Lab

ZMP

LOC100001503

Ensembl ID:
ENSDARG00000090496
Human Orthologue:
THSD7A
Human Description:
thrombospondin, type I, domain containing 7A [Source:HGNC Symbol;Acc:22207]
Mouse Orthologue:
Thsd7a
Mouse Description:
thrombospondin, type I, domain containing 7A Gene [Source:MGI Symbol;Acc:MGI:2685683]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa36254 Nonsense Mutation detected in F1 DNA Not yet available
sa28740 Nonsense Mutation detected in F1 DNA Not yet available
sa16268 Nonsense Available for shipment Available now
sa15789 Nonsense Available for shipment Available now
sa22945 Nonsense Mutation detected in F1 DNA Not yet available
sa28741 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36254
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110471 Nonsense 266 1648 2 29
Genomic Location (Zv9):
Chromosome 16 (position 50164773)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47030604
GRCz11 16 46997310
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCGGTGGTGTTGCCGACCTCCACGGCCGCCCCCGTGCGCGCTGTGCGC[C/T]AAACCCGCCGGCGGAAGGGCAAGGAGCGGAAGGGCAGCAGAGACCCGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28740
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110471 Nonsense 822 1648 11 29
Genomic Location (Zv9):
Chromosome 16 (position 50306370)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47171946
GRCz11 16 47098026
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCGCTATCGAGTGATCATTCAGAGGCCAGCCAATGGAGGTCAGGAGTG[T/A]CCAGACACCCTTTATGAAGAGAAAGACTGCGCAGCTCCATCTGTCTGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16268
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110471 Nonsense 1051 1648 15 29
Genomic Location (Zv9):
Chromosome 16 (position 50340522)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47206098
GRCz11 16 47131980
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGAATGGTCAAACTGGTCACGCTGCAGTAAATCCTGYGGCAGTGGTGTT[A/T]AAGTTCGCTCAAAATGGCTCAGAGAAAAGCCTTACAAYGGAGGAAGACCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7814
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110471 Essential Splice Site 1174 1648 18 29
Genomic Location (Zv9):
Chromosome 16 (position 50348666)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47214242
GRCz11 16 47139745
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAGGACTGTGTGCTGTCTGAATGGAGCCGTTGGACCTYCTGTGACCTGG[T/A]CAGCATTCATCCTTTATACCAGGGGTCTCCAATCTYRGTCCTGGAGGGCM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15789
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110471 Nonsense 1191 1648 19 29
Genomic Location (Zv9):
Chromosome 16 (position 50352274)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47217850
GRCz11 16 47143327
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCGTGCACTGGAAGAGGAGATCGGGAGAGGAYGGCGTTCGCTCTGCGTT[T/A]GCCTAAAGAGGGAGAGGACTGTCCTGTCAGCATGCAGACYGAGCCCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22945
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110471 Nonsense 1583 1648 27 29
Genomic Location (Zv9):
Chromosome 16 (position 50381790)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47247366
GRCz11 16 47172453
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCCCACCCTGCCCACCACTGTACAGCCTGGACGCGTCGGACGCACGTG[G/A]TACTTACAGCCTTTTGGAGCAGGTAAACGTGTTTCACTTCTGTTAGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28741
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110471 Nonsense 1584 1648 27 29
Genomic Location (Zv9):
Chromosome 16 (position 50381793)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47247369
GRCz11 16 47172456
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCACCCTGCCCACCACTGTACAGCCTGGACGCGTCGGACGCACGTGGTA[C/A]TTACAGCCTTTTGGAGCAGGTAAACGTGTTTCACTTCTGTTAGCAAATAC
Associated Phenotype:
Not determined