Busch Lab

ZMP

ENSDARG00000090467

Ensembl ID:
ENSDARG00000090467
Human Orthologues:
COL9A1, COL9A2, COL9A3
Human Descriptions:
collagen, type IX, alpha 1 [Source:HGNC Symbol;Acc:2217]
collagen, type IX, alpha 2 [Source:HGNC Symbol;Acc:2218]
collagen, type IX, alpha 3 [Source:HGNC Symbol;Acc:2219]
Mouse Orthologues:
Col9a1, Col9a2, Col9a3
Mouse Descriptions:
collagen, type IX, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88465]
collagen, type IX, alpha 2 Gene [Source:MGI Symbol;Acc:MGI:88466]
collagen, type IX, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:894686]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa24790 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30455
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122269 Essential Splice Site 304 607 19 28
Genomic Location (Zv9):
Chromosome Zv9_NA466 (position 10594)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150214.1 10594
GRCz11 KN150214.1 10594
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATTTTACAAAAAAATATCGATACATTTACGAAAAAGACTTTTGTTCTC[A/T]GGGTGACACAGGAAAGCAGGGTCCAGTCGGCCCAACAGGTCAACAAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24790
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122269 Essential Splice Site 542 607 28 28
Genomic Location (Zv9):
Chromosome Zv9_NA466 (position 22883)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150214.1 22883
GRCz11 KN150214.1 22883
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTATGTATAAATGTTTTCTAATTTTATCAATTGTGATTACTTCAAAAC[A/T]GGACCAGCTGGCAAGCCTGGCATTGGTAAAGATGGTCAGGATGGTGCCAA
Associated Phenotype:
Not determined