Busch Lab

ZMP

wu:fc54d09

Ensembl ID:
ENSDARG00000090442
ZFIN ID:
ZDB-GENE-030131-3802
Human Orthologue:
TRRAP
Human Description:
transformation/transcription domain-associated protein [Source:HGNC Symbol;Acc:12347]
Mouse Orthologue:
Trrap
Mouse Description:
transformation/transcription domain-associated protein Gene [Source:MGI Symbol;Acc:MGI:2153272]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa18006 Nonsense Available for shipment Available now
sa27935 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22073 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17251 Nonsense Available for shipment Available now
sa10196 Nonsense Available for shipment Available now
sa9226 Nonsense Mutation detected in F1 DNA Not yet available
sa15065 Essential Splice Site Available for shipment Available now
sa35253 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18006
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122245 Nonsense 685 3852 17 73
Genomic Location (Zv9):
Chromosome 12 (position 18978594)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17831977
GRCz11 12 17953851
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAACCTAACCACATCTGCTCTCTTTGCCACCATCCTGGTGGAGTATCTGT[T/A]GGAGCGTCTGCCTGAAATGGGCTCCAATGTGGAGTTATCAAACCTKTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27935
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122245 Essential Splice Site 779 3852 18 73
Genomic Location (Zv9):
Chromosome 12 (position 18980875)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17834257
GRCz11 12 17956131
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATCTCCTGTACCAGGAGTTTCTGCCTTTGCTGCCTAATTTGCTGCAAG[G/A]TGAGTGAAATTACTAACTTCATGTCAAAATAATGTACTGTTTCCACTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22073
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122245 Essential Splice Site 1636 3852 35 73
Genomic Location (Zv9):
Chromosome 12 (position 19015093)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17868028
GRCz11 12 17989902
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCTCCACCAGCACTGCCCGCCTCGACCTGCAGTTCCAGGCTATCAAGG[T/C]GAATAACACTGAAGCGTATCCTGCTAGAATTGATTGAATGCGCTTGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17251
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122245 Nonsense 2201 3852 45 73
Genomic Location (Zv9):
Chromosome 12 (position 19042935)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17895321
GRCz11 12 18017195
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTGCAGCGGGGTATTGCAGCATGCATGACCTGTGGAAACACCAAAGTGK[T/A]AAGGGCAGTCCATTCCCTCCTGTCCAGGCTCATGAGCACCTTCCCCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10196
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122245 Nonsense 2340 3852 48 73
Genomic Location (Zv9):
Chromosome 12 (position 19049868)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17902254
GRCz11 12 18024128
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TYAAGATGAGGCTCTCGGTTATGAATATGGAAATGAGGAARAACTTCATC[C/T]AGGTCATTCTCACTTCCCTCAKCGAGAAATCTCCCGATCCAAAGATTCTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5600
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122245 Essential Splice Site 2817 3852 56 73
Genomic Location (Zv9):
Chromosome 12 (position 19070661)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17922822
GRCz11 12 18044696
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACCCGCCATCTTTCCAGAGTACCAGCTGTGGGAAGATCACTGGATCCGG[T/C]GAGTTGAATGACCAGTTGAATGACCAGTAACAGAGAACNAAAAAAAACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9226
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122245 Nonsense 2979 3852 59 73
Genomic Location (Zv9):
Chromosome 12 (position 19080907)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17933068
GRCz11 12 18054942
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGACCTGGAGAAACAGACTGCCGATTGTATCTGACGACCTTTCYCATTG[G/A]AGCAGCATTTTTATGTGGCGTCAGCACCATTATCAAGGTATGACAAARTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27936
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122245 Nonsense 2990 3852 59 73
Genomic Location (Zv9):
Chromosome 12 (position 19080940)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17933101
GRCz11 12 18054975
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACGACCTTTCTCATTGGAGCAGCATTTTTATGTGGCGTCAGCACCATTA[T/A]CAAGGTATGACAAAATATCAAAACTTAGGGTTCCCATAGGTCATGGGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15065
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122245 Essential Splice Site 3277 3852 66 73
Genomic Location (Zv9):
Chromosome 12 (position 19107695)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17959856
GRCz11 12 18081730
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACTCCGGTCAGCAACAGCCCAGTTCGGCAGCWGCCCAGACGCACTCCGC[A/T]TCTGACCCGGGTCCCATTCGTGCCACGGCTCCCATGTGGCGCTGCAGTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35253
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122245 Nonsense 3659 3852 71 73
Genomic Location (Zv9):
Chromosome 12 (position 19126635)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17978796
GRCz11 12 18100670
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGTTAAAGGAATGGGCGCTGCACACTTTCCCCAATGCCACAGACTATT[G/A]GACCTTCCGCAAAATGTTCACCATCCAGCTTGCTCTAATTGGCCTAGCGG
Associated Phenotype:
Not determined