Busch Lab

ZMP

si:ch211-199m9.1

Ensembl ID:
ENSDARG00000090439
ZFIN ID:
ZDB-GENE-081103-63

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa20300 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20300
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126465 Nonsense 379 1021 3 9
ENSDART00000133238 None None 443 None 5
Genomic Location (Zv9):
Chromosome 4 (position 30176209)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 56179791
GRCz11 4 58246082
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGAGAGCGGCATAAACGTCACTGACACCTCAGTGTATTCTGGGATCTG[C/A]ACTGAGATCTTCAAGGAGGAATCTGTGATTCATCAGAGGAAAGTCTACAG
Long Flanking Sequence:
AGCGACGAGCATCAAGCCAGCAGAATCATCTCCCACATCAGAAGAGCAAGAAGCCTCCAGATCATGTGCCACATACCCGTCTTCTGCTGGATCTCCTCCACTGTGCTTCAGAAGCTCCTGGAAGAAGATGTGAGGGCAGAAATCCCTAAAACTCTGACTGAGATGTACATCCACTTCCTGCTGATTCAGATCGACACGAGGAAGCAGAAGTATGAAGAGAGGGATCCAAAGAATTTGCAGGGAGATCCAGAGAAACTGCAGTCCAACAGGGGAGTGATCAACACACTTACAGTGGCTTTCAGACAGCTAAAGTTCAAAGTGAGGAAGCAGAAGTATGAAGAGAGAGATCCAAAGAATCTGCAGTCCAACAGAGGAGTGATCCTCAAACTTGCTGAAGTGGCTTTCAGACAGCTGATGAAGAGCAATGTGATGTTCTATGAGGAGGACCTGATTGAGAGCGGCATAAACGTCACTGACACCTCAGTGTATTCTGGGATCTG[C/A]ACTGAGATCTTCAAGGAGGAATCTGTGATTCATCAGAGGAAAGTCTACAGCTTCATCCATCTCAGCTTTCAGGAGTTTCTGGCTGCTTTCTTTGTGTTTTACTGCCATTTAACAGAGAACAGAGAACCGCTGAGGGTGATTTATGAGATAGAATATTCAAATAATCAACATCTACAGGCCAGCTCTGAGAAGTCTCTGTATGATCTGCTCAGTTCAGCAGTATATAAAGCTGTCATGAGTAGTAATGGTCATCTGGATCTGTTTCTGCGGTTCCTGCTGGGCGTCTCACTGGAGTCCAATCAGAGACTCTTCCAGGATCTGCTGACACACACAGAGGAGAGCTCAGAGAACATCAGGAGAATCACACAGGACATTAAAGACATGATCAAGAGAGATAACCCTCTCTCAGCTGAAAGATCCATCAATCTGTTCCTCTGTCTGCTGGAGGTGAAAGATCAGACTCTGGCCAGAGAGATTCAGGAGTTTGTGAAATCAGACAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26323
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126465 Nonsense 917 1021 9 9
ENSDART00000133238 None None 443 None 5
Genomic Location (Zv9):
Chromosome 4 (position 30189426)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 56193008
GRCz11 4 58259299
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGGACGCTGTTACTGGGAGATTGACTGGAGTGGAGATCATGATGTGTG[T/A]ATATCAGTGTCATATAAGAGCATCAGGAGGAAGGGAGGTGTTGAGTGTTG
Long Flanking Sequence:
CTCTCTCCCTCTCTCAATCACACACGCACTCACACACACACTCTCTCTCTCCCTCTCTTAATCACACACACAAACACACATACACACACACACATACACGCAAGCATGCACGCGCACACACACACACACAAACATACTCTCTCACACACACACAACACACACGCACGCACGCACACACTCTCTCTCTCTGTCTCTCTCACACACACGCACGCACACACTCTCTCTGTCTCTCTCACACACACGCACACTCACACACATCTGTGGTTATAAATGTGTGTGTTCTTGTGTTTAGATGTCTGTTTCCTTACTCTGGATCCAAACACAGCAGACACTCAACTCATTCTGTCTGAGGAGAACAGAGAGGTGAAGAGTGTGAGAAAGAATCAGCCGTATCCTGATCATCCAGACAGATTTGATTATTGGCCTCAGGTGTTGTGCAGAGAGAGTGTGTGTGGACGCTGTTACTGGGAGATTGACTGGAGTGGAGATCATGATGTGTG[T/A]ATATCAGTGTCATATAAGAGCATCAGGAGGAAGGGAGGTGTTGAGTGTTGGTTTGGAAATAATGCTCAGTCCTGGAGTTTGATCTGTGATTCCTCCAGTTTCTCATTCAGTCACAATAACACACGCACTAAGCTCTCAGTGAAGCCGCTCAGCAGGAGAATAGGAGTGTTTGTGGATCAAAGTACAGGAACTCTGAGCTTCTACAACATCTATAGAGACACAATGAGCCTCATCCACTCAGTCCAGACCACATTCACTGAGCCGCTCTGCCCTGGGTTTACTGTTTGGTCTGGATCATCAGTGAAACTGAGCTGAAGACTGACAAGAGATTTACCCAGAATCCACTGCAGGAGCAGTCAGCAGCAGTGTGTGTGCGTGCGTGTGTGTGTGTGTGTGTGTGTGTGCGCGTGTGTGTGTGCGTGTGTGTGTGTGTGTCTGTCGTAACTGCCGTCGTGAACGCAGAAGGAGCCCAATGTGAAACAATTCAAGTGATGTGCCTA
Associated Phenotype:
Not determined