Busch Lab

ZMP

ENSDARG00000090419

Ensembl ID:
ENSDARG00000090419
Human Orthologues:
C13orf23, NUP214
Human Descriptions:
chromosome 13 open reading frame 23 [Source:HGNC Symbol;Acc:20291]
nucleoporin 214kDa [Source:HGNC Symbol;Acc:8064]
Mouse Orthologues:
2810046L04Rik, Nup214
Mouse Descriptions:
RIKEN cDNA 2810046L04 gene Gene [Source:MGI Symbol;Acc:MGI:1919933]
nucleoporin 214 Gene [Source:MGI Symbol;Acc:MGI:1095411]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa25911 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25911
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123827 Nonsense 442 1039 2 2

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 47442987)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 47448159
GRCz11 2 47299851
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCACCTGCAGCACCATCATCTTCACCATCACCAAACTCTCCCCCATCTT[C/A]ATCATCCTCACCTGCAGCACCAAACTTTCCATCATCTTCATCATCCTCAC
Associated Phenotype:
Not determined