Busch Lab

ZMP

tank

Ensembl ID:
ENSDARG00000090402
ZFIN ID:
ZDB-GENE-060929-308
Description:
TRAF family member-associated NF-kappa-B activator [Source:RefSeq peptide;Acc:NP_001070068]
Human Orthologue:
TANK
Human Description:
TRAF family member-associated NFKB activator [Source:HGNC Symbol;Acc:11562]
Mouse Orthologue:
Tank
Mouse Description:
TRAF family member-associated Nf-kappa B activator Gene [Source:MGI Symbol;Acc:MGI:107676]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa34773 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34773
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122358 Nonsense 4 180 1 2
Genomic Location (Zv9):
Chromosome 9 (position 52824687)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 51916370
GRCz11 9 51528297
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCACAGCAAAAAAACCTCATTATTCTGATCTGTTTCCAGAGCAGTTTT[C/A]GATGCCCATCCAGTGCACGGACGGCCCTGTGGAGCAAACCGAGGAGCCGT
Associated Phenotype:
Not determined